Atlantis Insurrection
"Personne ne demande à devenir un Héros, sauf que parfois ça finit comme ça..."

Et si ce Héros, c'était toi ? Tu es l'un des meilleurs dans ton domaine (Biologiste, Chirurgien, Infirmier, Diplomate, Démineur, Maître chien...) et on te propose de participer à l'expédition la plus fabuleuse mais aussi la plus dangereuse : l'expédition Atlantis.
Auras tu le cran de rejoindre Atlantis pour découvrir ses mystères et affronter les dangers de cette galaxie ?

Tu peux aussi incarner les personnages importants de la série (Weir, Sheppard, McKay, Lorne, Teyla....) Bon niveau RP demandé.
On recherche de nombreux personnages inventés.
http://www.atlantisinsurrection.com/t387-personnages-vacants


Si tu te sens capable de franchir ce pas, tu es des nôtres ! Clique sur l'image ;-)


RPG sur Stargate Atlantis
 

MJ24 : Au coeur de la cité : Naviguez en paix !

 :: Cité d'Atlantis :: Les autres ailes de la Cité Voir le sujet précédent Voir le sujet suivant Aller en bas
Sam 28 Oct - 20:55
avatar
√ Arrivée le : 01/08/2015
√ Messages : 379
Voir le profil de l'utilisateur
Equipe 2 Naviguez en paix
Chronologie 18 octobre 2017


Pour naviguer, il faut de beau bateau ! L'idée des canots ne fut pas bête ! Et cela sert bien ! Puisque bon, dès que les aventuriers se mirent à marcher dans l'onde, ils remarquèrent qu'il ne fallut pas beaucoup de pas, pour en avoir jusqu'aux épaules et le sol était en pente.

Une fois dessus et au sec, il n'y avait pas beaucoup de chemin… outre la cuvette devant eux, les aventuriers remarquèrent très vite, que la végétation en face était sur un mur… Et le seul endroit non coloniser par la végétation, bougeantes qu'est la mousse… était une sorte de couloir. Un endroit aussi large que ceux qu'ils connaissent dans la cité. Le plafond était visible de temps à autre, quand la mousse ou les lianes ne le recouvrait pas. La lumière de la cité était présente, même si par moment, certaines étaient brisées.

Tout se passait relativement bien, quand l'un d'entre eux remarqua sans peine que les « troncs flottants » les suivaient depuis le début. L'un d'entre eux, ouvrit sa gueule, à la manière d'un crocodile pour attraper une pagaie et le reste fit de même. Il n'y avait pas de réellement dents, mais une pression impressionnante. Impossible de les faire lâcher, malgré leurs petites tailles d'un mètre. Et ils commençaient à engloutir les pagaies en les avalant à la manière d'un boa.

Soudainement, il eut un bruit cristallin, Ford put reconnaître son hymne de Rambo. Au-dessus, deux entre les différentes lianes, l'une d'entre elle était plus verte que les autres et s'enroula autour de Natasha, pour la soulever hors du canot, à la manière de balançoire, la serrant doucement pour la mettre vers le plafond (il est à quatre mètres de vous). Le reste du corps de la serliane notamment la tête descendit vers un des troncs croco et se mit à feuler dans un bruit à vous tordre les tympans… le cristal ça fait mal aux oreilles oui… Cela fit lâcher les troncs de leurs propres objets que sont les pagaies !! Gueule ouverte, elle sortit ses crochets pour mordre le tronc croco qui tenait la pagaie de Natasha. D'ailleurs, la fin du corps de la serliane prit la pagaie, pour la donner à Natasha.

La réaction ne se fit pas attendre… le tronc croco se mit à convulsionner et à lâcher l'objet pour se tordre au-dessus de l'eau, comme un poisson frénétique. La couleur commençait à virer au noir ! Les autres tronc croco, commencèrent à lâcher les pagaies… Déjà la serliane se réarmait pour fondre sur un autre tronc qui l'esquiva…

Vos actions :
  • Natasha est en sécurité dans la canopée du plafond, dans les anneaux de son copain. Elle sera immédiatement redescendue dans le canot quand il n’y aura plus de tronc croco, ou si la serliane meurt.
  • Les tronc croco vont se montrer agressif et essayer d’attraper la serliane, qui va essayer de les mordre. Pour informations, elle ne touchera nullement l’eau et évitera toute giclée… Elle va protéger aussi Ford. Les autres, elle s’en fou pour le moment.
  • Les troncs croco sont aussi résistant que du bois flotté, non pas de dents, mais une pression de la mâchoire qui peuvent vous briser vos os. Il en a quatre (donc un qui convulse méchamment)
  • Après cela, vous pouvez continuer l’explorations, il y aura de nombreuses salles : cinq au totale.
  • Vous pouvez essayer de communiquer avec la serliane.




-----------

  • Jusqu’à Lundi 06 Novembre
  • Je vous guiderai par moment sur kles réactions des créatures et la découvertes des salles, je peux poussez vos poste plus loin... vous êtes très libre de vos actions pour explorer les salles notaments.



Revenir en haut Aller en bas
Lun 6 Nov - 22:09
avatar
√ Arrivée le : 22/01/2016
√ Messages : 893
√ Localisation : dans la galaxie Pégase


Dossier Top Secret
√ Age: 27 ans
√ Nationalité: États-Unis États-Unis
√ Gêne: Inoculation
Voir le profil de l'utilisateur
Aiden Ford


Donc, nos assaillants, vaincus par la force de notre inaction, la vertu de notre diplomatie et le fort pouvoir humidifiant de l’eau verdâtre, nous délaissèrent bientôt, regagnant, qui les frondaisons, qui les racines cachées et qui son parterre de fleurs ! Le Major nous regroupa tous autour d’elle, nous primes le temps de nous reposer un peu, histoire de s’hydrater et de manger un bout : affronter une faune-flore E.T, c’est un truc qui peux vous donner soif ou puiser toutes vos forces. Puis il fallut bien se dire que la zone à couvrir était plutôt vaste, aussi Le Major, Allen et moi en arrivèrent au fait très simple mais désagréable de devoir scinder le groupe en deux sous-groupes. A Frei le groupe 1 constitué de Frei, Femens, Ayoun et Hamilton ! A moi Allen, Bricks et Avalon !

Pour nous la voie aquatique et pour les autres la voie terrestre. Je déteste ça les sous divisions ; c’est un truc qui coûte cher dans les films d’horreur, on est plus fort dans l’unité mais bon, on fait pas toujours ce qu’on veut ! Donc on déploie l’un des canots et le met à l’eau, l’autre on le garde pour le secours en cas de crevaison de celui-ci, je m’en charge : c’est moi le portefaix ! Bon je distribue les consignes aux autres moi ! Le groupe Frei déjà sur le départ !

« Bien ! Alors pour commencer ! Puisque nous avons une civile, les présentations d’usage : Docteur Natasha Avalon, kinésithérapeute !? Je vous présente, le soldat Bricks, Nelly formation de pilote de chasseur spatial, c’est vous dire si elle est douée ! La sous-lieutenant Allen, Pedge ! Un bon sous-off, un chef respectueux et sans doute le meilleur officier de la galaxie après le Major Frei et quelques autres ! Et moi, Lieutenant Ford, Aiden ! Mutant par accident mais héros par volonté ! Bon ! Voilà pour les politesses ! Si on y allait ?»

Je fis signe à Avalon de prendre place à bord, une fois qu’elle eut fini de saluer ses deux nouvelles camarades de galère !

« Bien ! Allen ! Bricks ! Vous, vous ramez ! Bricks à droite et vous Allen à gauche, ou selon votre main directrice, si vous êtes gauchère plutôt que droitière ! Moi je vais donner l’impulsion au canot puis je prendrais place en arrière, pour surveiller les agressions éventuelles, je les sents pas moi ces tronc bizarres ! Des questions ? »


Nastasha Avalon


Natasha écouta les présentations de l’équipe en songeant que Ford avait eu une bonne initiative. S’il ne l’avait pas fait, elle leur aurait demandé qui ils étaient, au moins histoire de pouvoir nommer tous ces visages inconnus et de savoir ce qu’ils faisaient dans la vie. Elle était donc la seule civile… le moins qu’on puisse dire c’était qu’elle se sentait plutôt bien encadrée. Ford en faisait une tonne pour encenser chaque personne qu’il présentait et elle se dit qu’il devait lui importer de donner une bonne image de son équipe, ou bien c’était un adepte de la flatterie.

«Ravie de faire votre connaissance» répondit-elle simplement.
« Moi de même » fit Pedge en répondant à la civile.
« Première mission officielle ? », s’enquit la militaire, histoire de faire la conversation.
« J’ai déjà traversé la porte mais c’est la première fois que je m’aventure en milieu hostile. Et vous ? »
« J’ai perdu le compte. J’espère que vous ne vous inquiétez pas. »
« Avec une escorte pareille ça devrait aller, » plaisanta t-elle.
« Je pense aussi », répliqua Pedge avec une lueur d’amusement dans les yeux malgré son allure bien morne.» « Et vous êtes de loin la plus redoutable en charmeuse de serpent.. »
Natasha lui répondit par un sourire timide. Ça lui faisait bizarre de se retrouver entourée de militaires, elle n’avait pas l’habitude. Il allait falloir mettre les bouchées double pour être à la hauteur ! Ford distribua les consignes et Natasha secoua la tête pour signifier qu’elle n’avait pas de question.

Pedge Allen


Les consignes étaient tombées. Elle ferait donc partie de l’équipe supervisée par Ford. Dire qu’elle était enchantée serait faux. La texane n’était pas fan du style de commandement de l’homme, surtout depuis la mission sur Renégat. Elle espérait vraiment qu’il avait progressé. Ils écopaient donc du côté humide et navigable de l’exploration. Étant déjà quelque peu mouillée, cela ne la dérangeait pas outre mesure de prendre le large sur l’eau émeraude. La répartition était particulière, mais soit. Ils n’avaient pas de scientifique dans leur équipe, ils feraient donc très certainement de l’observation.

Ford se chargea de faire les présentations. Pedge leva les yeux au ciel quand il fit son petit show. En fait, il ne devait pas avoir changé du tout. Pourquoi faire de toute façon ? Il était trop imbu de lui-même pour cela. Bref, il allait falloir faire avec. On ne pouvait pas toujours être satisfait de l’officier au dessus de soi. Tant qu’il ne leur faisait pas prendre des risques à la con, pas de problème. Elle jeta un coup d’œil à Natasha qui devait découvrir le zigoto pour la première fois sûrement.

Elle fit un brin de causette avec Natasha, histoire de commencer à la connaître avant de s’avancer vers le canot. Ford distribua jusqu’au positionnement dans le bateau. Elle échangea avec Nelly si jamais elles avaient une main opposée, et elle prit place dans l’embarcation, tout en prenant une pagaie. « Pas de questions Lieutenant. »

Nelly Bricks


Alors ça pour une surprise.
Il ne suffisait pas que de faire le mort, il y avait eu d’autres solutions apparemment et Nelly les nota mentalement. Les serlianes n’étaient pas forcément mauvaises alors ? C’était étonnant, surprenant. Bref, c’était la découverte de l’inconnu.
En son for intérieur, la petite espagnole était plutôt soulagée qu’il n’y ai pas de blessé. Elle resta dans une formation classique en avisant ses collègues d’un regard jusqu’à ce que le major prenne sa décision.

Deux groupes et, miracle, joie ultime, Pedge y était !!
Super Texas Môman, on revient forcément en vie avec elle. Et puis, quelque part, Nelly voulait faire sa mission avec elle. Histoire d’affinité et de copinage, elle restait sérieuse avant tout mais c’était encore mieux avec. D’ailleurs, Natasha était aussi de la partie, ce serait pas mal d’en profiter pour la connaître un peu mais...c’est là que Monsieur Ford frappa.

Nelly leva un sourcil lorsqu’il parla de ses capacités de pilotage et du fait qu’elle était douée. Un petit sourire naquit au coin de ses lèvres à l’idée qu’une copilote pouvait être d’une telle utilité sur un pneumatique qu’ils seraient foutu de la balancer aux prédateurs pour faire diversion. Mais bon, ce n’était pas que ça qui la faisait sourire, il faut être honnête. C’était plutôt le discours, le côté “Ah, j’ai bien réussi à faire chanter God Save The Queen a un perroquet. Alors franchir une rivière verte bizarre, c’est du tout cuit pour Ford !!!”
Et là, BAM ! Retour de manivelle ultime où ça ne serait pas de la faute de Super-Fordy ! Tout le monde à l’eau pour le concours de t-shirt mouillé, il en aurait de la chance le chef avec toutes ces belles femmes autour de lui ! Elle le sentait gros comme une maison. Le pire, c’est qu’elle le voyait bien en minion jaune, avec son oeil noir, qui leur ferait un magnifique BWAAAAA en pointant le bateau.

Tout ça pour dire qu’elle se serait fait son petit fou rire toute seule si elle n’était pas en mission. Nelly trouvait ça très drôle et conservait sur son visage cette animation comique qu’elle réprimait. Elle salua Natasha silencieusement, se disant qu’elle aurait le temps de parler avec elle sur le bateau, puis s’installa à la suite de Pedge pour ramer.

« Dis, Pedge. N’envoie pas trop la dose, d’accord ? Si je compense mal avec mes petits bras on fera de jolis cercles dans l’eau ! »
« A vous de tenir le rythme Bricks », répondit Pedge avec un regard entendu.
« On fait la course ? La première à faire tourner inutilement le bateau ! » Fît Nelly malicieusement, comme si elle traduisait verbalement le regard de son amie.
« Négatif, on se concentre sur l’objectif. », répondit-elle directement sans tergiverser pour qu’elle ne sente pas d’ouverture à faire la gamine.
« Lieutenant, oui lieutenant... » Reprit-elle du tac au tac avec une expression martiale. Pedge opina du chef en plantant la rame dans l’eau.

Elle fît un moment de silence avant de se tourner vers Natasha.

« Sinon...heu...disons que les piqûres, ce n’est pas vraiment ma tasse de thé. J’en ai même sacrément peur, surtout s’il faut me couper le sein après. Donc soyez gentille les filles : si je me fais mordre, je compte sur vous deux pour me faire ça bien et vite. D’accord ? »

« Vous ne sentirez rien, promis,» lui répondit Natasha en souriant, se gardant bien de lui dire que si elle se faisait mordre par quelque chose de venimeux, la seringue serait certainement la dernière de ses inquiétudes face à la douleur provoquée par le poison.
« Pas de soucis Nelly, je sais couper net de façon propre et précise. », répondit Pedge de son humour pince sans rire, rebondissant plutôt sur l’aspect “découpage de sein”.

Un sourire amusé se dessina sur les lèvres de Natasha suite à la pique d’Allen et elle dû se faire violence pour retrouver son sérieux, peu désireuse de vexer Nelly.
L’espace d’un instant, Nelly écarquilla les yeux et pressa sa poitrine d’un bras protecteur.
« Nan c’est pas vrai...tu n’oserais pas me faire ça... »
« On n’arrête pas de ramer Bricks. », fit Pedge sans répondre directement à sa question sous-jacente.

La petite espagnole s'exécuta en recommençant à pagayer.
Elle murmura plus bas, comme quelqu’un qui ne voulait surtout pas que ce soit vrai :
« Tu oserais pas... ». Pedge ne tourna même pas le regard vers elle, restant silencieuse.

Bon, elle avait exclue Monsieur Ford de la requête parce que c’était un homme et qu’elle le voyait bien, avec sa super force, lui passer la seringue, le piston et le reste à travers le bras avec un magnifique “oups”. Mais avec le risque de mourir en cas d’empoisonnement, elle ne s’en formaliserait pas. C’est juste que les aiguilles, ça lui faisait réellement peur. Pedge l’avait déjà vu, elle pourrait surement le comprendre. Mais il valait mieux prévenir à l’avance.


Aiden Ford


Pas de questions, donc une fois tout le monde installé comme demandé, je commence à pousser le canot, il met un moment à se mouvoir puis finalement commence à bouger. Je m’enfonce dans l’eau en avançant puis quand l’eau m’arrive à la taille, je monte dans le canot. Les rameuses se mettent d’accord sur le rythme de travail et moi je me concentre sur l’activité de l’eau autour de nous. Vous savez quand on se concentre sur un objectif on subit ce qu’on appel l’effet tunnel : le cerveau se focalise sur une zone correspondant à votre sujet de concentration et du fait, vous pouvez louper un truc qui se passe devant vos yeux (genre compter combien de passes se font des basketteurs et vous remarquez pas le type à tête de cheval qui passait derrière eux), donc je suivais pas aussi bien les causeries de mes trois camarades (j’ai deux oreilles, pas plus !), concentré que j’étais sur les bruits de l’environnement extérieur.

Un moment il me sembla bien distinguer un mouvement parmi les “troncs” qui flottaient mais je n’en étais pas certain. Puis il commença à être évident que la présence de “troncs” se multipliait «Pas trop de remous dans l’eau ! On pourrait nous prendre pour une proie en train de nager ! » Je commençait à sortir le pistolet à seringues hypodermiques ; Inutile de tuer des créatures qui ne font que défendre leur territoire. Bien vite il commença à y avoir un vrai mouvement de convergence vers le canot : « Troncs à 12 heures ! Troncs à 3 heures ! Troncs à 9 heures ! Ils convergent vers nous ! » Avalon signala un tronc venant vers nous ! « Il nous encerclent ! Tenez-vous prêtes ! Ils vont attaquer !»Ces mots à peine prononcés que déjà les espèces “d’alligatroncs” passaient à l’offensive : en chopant les pagaies pour, soit goûter les “pattes” de l’animal qu’il croyait que nous étions, soit par calcul pour neutraliser des armes potentielles ou enfin, ce qui serait pire : tenter de jeter à l’eau les occupantes du canot.
« Tenez bon Bricks ! Tenez bon Allen ! Je vais tenter de m’occuper de vos adversaires ! Docteur ! Restez bien à l’abri au fond du canot ! »

Je tire sur la bête qui tient la pagaie d’Allen, puis me tourne du côté de Bricks, je n’y arriverais pas elle est devant la cible ! Bon tant pis ! Je m’approche d’elle et, par-dessus son épaule attrape le manche de sa pagaie : « A trois, vous lâchez la rame, Bricks et vous sortez votre paralysant pour dégommer cette horreur ! Prêt ? Un … Deux … Trois … ! » La chose avait de la poigne elle tirait avec la force de l’avidité ! Puis soudain, un drôle de chant cristallin sur un air familier : on dirait Bruce Springsteen ! J’ai pas le temps de vérifier que notre civile se fait soudain enlever par une serliane. Bravo ! Comme si on avait pas assez d’ennuis ! Je m’attends à me faire choper ou attaquer par le ciel mais au lieu de ça la serliane descend et pousse un cri bizarre contre le bestiau qui me tient la grappe. La plante-serpent crache et feule sur le “tronc” et la bête lâche ! Puis se met à convulser avec violence ! « Merci ma grande ! Tu fais gaffe avec le Docteur Avalon ? Là-haut elle ne peut pas se défendre ! », notre amie commune à Avalon et moi, s’empare de la pagaie que je tiens et remonte au plafond. Bon plus qu’a faire fuir ces sales bêtes ! « Utilisez les zat ou les flingues wraiths ! Si on peut éviter de tuer des espèces étrangères ce serait mieux : la mission avant tout ! Mais ne risquez pas vos vies pour ça ! Si vous devez les tuer pour survivre alors tuez ! »

Un “alligatronc” tenta de me chopper la main et mon ami la liane lui fit changer d’avis, d’accord ! Elle protège Avalon et pas qu’elle ! J’ai l’impression que moi aussi je suis son protégé ! Vivement qu’on s’en débarrasse de ses saletés et vite ! J’espère que Bricks et Allen s’en sortent bien, elles aussi ! Avalon cria pour prévenir Allen d’une attaque, un coup fut porté au fond du canot, ces saloperies venaient-elles de comprendre que c’était nous la bouffe ou attaquaient-elles un poisson inconnu ?

Nastasha Avalon


Le groupe s’était scindé en deux et il incombait à ses trois camarades et à elle-même de traverser l’étendue d’eau pour aller voir ce qui se cachait de l’autre côté. Sa nouvelle amie la serliane était repartie après l’appel des autres membres de sa race et Natasha regretta que la séparation soit aussi brusque. Il lui serait difficile d’oublier l’échange qu’elle avait eu avec cette étrange créature, mais que pouvait-elle espérer de plus ? La serliane avait probablement d’autres chats à fouetter que de passer la journée à lui faire la conversation dans une langue qu’elle ne pouvait comprendre et vice versa, elle-même avait été envoyée ici pour une bonne raison et il était temps d’avancer.

Dès le début, ces troncs flottants ne lui avaient pas inspiré confiance. Dans une jungle avec de l’eau verte… quelle était la probabilité pour que ces morceaux de bois s’animent ? Bien trop élevée à son goût. Elle posa sa caméra une petite minute pour remplir un tube avec l’eau du marais, essayant de ne pas trop toucher le liquide avec sa peau, et rangea l’échantillon dans son sac avant de reprendre l’appareil pour faire un gros plan sur le bois flottant.


«Je paris un paquet de cookies que ces trucs-là vont venir nous emmerder», lança-t-elle en désignant les troncs.

Hélas, il fallait explorer. Ils firent donc leur travail et grimpèrent dans la première embarcation, la seconde bien à l’abri sur le dos du Lieutenant Ford. Natasha se positionna à l’avant, son sac à côté d’elle dans le canot, et laissa aux autres le soin de ramer pendant qu’elle filmait les alentours avec autant de soin que possible. Elle fut donc l’une des premières à remarquer que les fameux troncs se rapprochaient dangereusement d’eux.


«J’ai gagné mon pari. Attention aux troncs !» S’exclama-t-elle.

Les créatures se rapprochèrent beaucoup trop vite pour leur laisser le temps de réagir. En moins de temps qu’il ne fallait pour le dire, elles s’attaquèrent aux pagaies qu’elles entreprirent de dévorer goulument. Natasha balaya rapidement les environs du regard : pas moyen de revenir en arrière ou d’accoster le mystérieux couloir en face, ils étaient en plein milieu du bassin et ces créatures ne les laisseraient pas aller plus loin. La situation n’était pas si désastreuse pour l’instant, ils pouvaient peut-être réagir en tirant à bout portant sur les troncs… ou bien en les brûlant ! Est-ce que le feu pouvait les effrayer ? Il fallait juste un produit inflammable et un briquet et…

Un soubresaut eu lieu et le canot bougea. Saloperie ! Ces bestioles ne se contentaient pas d’attaquer les pagaies, elles essayaient aussi de faire chavirer l’embarcation. Balançant sa caméra dans un coin du canot, Natasha porta précipitamment la main vers son arme, paniquée. C’est alors que se fit entendre un sifflement bien connu et quelque chose s’enroula brusquement autour de ses hanches avant de la soulever dans les airs à plusieurs mètres du sol. La kiné en eut le souffle coupé et poussa un cri de surprise, s’attendant à se faire dévorer par un quelconque prédateurs venu d’en haut alors que son attention était portée vers le bas. Son cri s’étouffa dans sa gorge lorsqu’elle réalisa que la chose qui la tenait fermement n’était autre que sa “nouvelle amie” la serliane et elle regarda autour d’elle d’un air paniqué. Elle était suspendue à plusieurs mètres dans les airs, maintenue par le corps fin de la serliane dont l’extrémité était enroulée dans les branchages, au dessus de l’eau et donc de tous les prédateurs visibles… et potentiellement cachés. Si la serliane la lâchait c’était un aller simple pour les crocodiles - Parfait ! Vraiment parfait ! Intérieurement, elle pria pour que le serpent continue à la tenir tout en admirant sa force : elle faisait 62 kg et l’animal la maintenait comme si elle ne pesait rien.

La tête de la serliane la regarda quelques instants et émit des sons que Natasha interpréta comme des paroles qu’elle ne pouvait comprendre.


«D’accord… tu essaies de m’aider c’est ça ?» Hasarda t-elle sans parvenir à cacher son regard paniqué.

Elle ne voyait pas d’autres explications à ce comportement étrange. D’ailleurs, la tête de la serliane fondit vers l’eau et se mit à produire un son horrible. Natasha gémit et se boucha les oreilles en plaignant ses trois camarades qui étaient aux premières loges. Elle avait un peu l’impression d’être l’une de ces héroïnes qui ne servait à rien dans les films d’action, contrainte de regarder les évènements pendant qu’elle se faisait balader par la grosse bestiole gentille. Hors de question d’attrapper son arme et de tirer, elle ne pourrait prévoir la réaction de la serliane si ça arrivait.

Elle vit le serpent se jeter sur l’un des troncs et s’emparer de la pagaie avec l’autre extrémité de son corps. Si Natasha n’arrivait pas à capter l’intégralité de l’action depuis son poste d’observation instable, elle comprit que la serliane était en train de risquer sa vie pour les défendre. D’ailleurs, la queue remonta jusqu’à elle pour lui confier la pagaie. Natasha eut envie de rire jaune : avec un câlin et quelques mots, elle avait visiblement gagné l’amitié et la protection de ce qui semblait être l’un des plus dangereux prédateurs des environs. Sur ce coup là, elle était plutôt fière d’elle ! Tenant fermement la pagaie dans ses mains, Natasha observa la suite du combat et les actions de ses collègues avec une réelle angoisse. Si elle était en sécurité en haut de son perchoir (tant que la serliane voulait bien la tenir du moins) ce n’était pas leur cas. Elle remarqua alors un tronc se glisser dans l’angle mort de l’une de ses camarades et ouvrir grand la bouche, se préparant certainement à attaquer.


«ALLEN ATTENTION ! » Cria t-elle pour être entendue dans la cohue.

Pedge Allen



L’embarcation allait bon an mal an, propulsée par les pagaies des deux jeunes femmes qui ramaient somme toute à l’unisson pour faire avancer le rafiot pneumatique. Les troncs qui flottaient et qui paraissaient trop inertes pour être honnêtes n’inspiraient pas confiance à la texane, qui était tentée de prendre les paris avec la kiné. Mais ce serait perdre trop facilement tant cela était prévisible, quand on se basait sur la flore et la faune locale. Tout semblait doté d’une certaine forme d’intelligence et d’une capacité à se mouvoir.

Ils n’avaient pas beaucoup de choix dans la direction à prendre. En face, le mur était recouvert de végétation, et ils suivaient donc un couloir comme on pouvait en retrouver dans les autres ailes de la cité, moins arborées et plus vivables. C’était assez déroutant, et pourtant, le décorum était familier sans l’être. Quelques lumières subsistaient pour éclairer l’ensemble du tableau, même si Pedge n’en avait cure, étant dotée des fameuses lentilles. La végétation était présente de partout, colonisant depuis des lustres cet endroit. Un véritable écosystème s’était mis en place en l’absence d’un contrôle drastique de la propagation. Est-ce que ce laboratoire, car ça devait en être un, avait été laissé à l’abandon par les anciens en même temps qu’ils avaient déserté la cité ? Probablement, il n’y avait pas d’autres explication possible en fait.

Natasha fit la vigie et elle annonça qu’il fallait faire attention aux troncs. L’instant d’après, une de ces bestioles referma sa mâchoire sur sa pagaie. Elle s’attendait à ce qu’elle tire, et elle ne fut pas déçu du voyage. La pression était importante sur l’ustensile de navigation, et Pedge eut toutes les peines du monde à ne pas voir l’objet s’éclipser purement et simplement de ses mains sous la contrainte du tronc alligator. Heureusement, ce dernier ne semblait pas avoir de dent. Il ne pouvait pas briser l’objet en deux trop facilement, même si la pression dont il faisait preuve ne le laisserait pas intact trop longtemps. Ford tira. L’animal ne couina même pas, mais des morceaux d’écorces se détachèrent de lui tandis qu’un liquide blanchâtre similaire à celui de la racine de toute à l’heure s’échappait du point d’impact. Plusieurs balles se plantèrent comme dans un tronc, et il finit par lâcher la pagaie, tout en s’éloignant de l’embarcation.

Pedge se retourna pour aider les autres, quand soudainement, Nastasha se volatilisa de son champ de vision. Elle venait d’être happée par une Serliane qui venait de l’envoyer au plafond pour la protéger de l’attaque des troncs. L’attaque des troncs… Un sacré titre pour un porno. Que faire ? Car peut-être que ce n’était pas seulement pour la protéger, mais pour se garder un bout de viande quand les troncs seraient passés. Dégommer l’animal qui venait de kidnapper la kiné ? C’était vraiment trop risqué que de viser au jugé alors que ça bougeait dans tous les sens. Elle risquait plutôt d’abattre l’humaine avant de toucher le corps de la liane vivante, sans parler du fait que le projectile risquait de passer au travers. Seulement voilà, le comportement de l’animal (ou du végétal, c’était selon) semblait plutôt amical, dans le sens où il semblerait qu’il était en train de protéger la française plutôt que de la menacer, surtout quand elle se projeta pour gueuler (façon de parler) sur un tronc et que ce dernier fut pris de convulsion. Elle cherchait clairement à aider !

Bon, du coup, il n’y avait pas à se soucier de la civile perchée. Elle reporta son attention sur le reste de l’équipe quand soudainement, la vigie là-haut lui hurla de faire attention. Attention oui, mais à quoi ?? Il y avait du mouvement sous le bateau et sur les côtés. Manifestement, les troncs essayaient de les faire chavirer. Elle se retourna pour voir une de ces créatures, gueule grande ouverte, qui se lançait directement sur elle. Ni une ni deux, la militaire lui colla la pagaie dans la gueule avant que la mâchoire puissante ne se referme sur le bord du canot pneumatique qui n’aurait pas résisté à une pression pareille. Vu que les morceaux de bois les prenaient désormais pour cible, il ne fallait pas être clairvoyant pour se dire que s’ils se retrouvaient tous dans l’eau, ils ne feraient pas long feu.

« Ok ok… » fit Pedge en voyant la pagaie exploser dans la gueule de l’animal. Elle arma son Colt M4. Hors de question de faire dans le tir de parade ou dans le non lethal, elle avait failli précipiter les occupants du canot dans l’eau, cette saloperie. « Je n’ai que des armes létales lieutenant », fit Pedge dans un souffle. La militaire lui envoya quelques balles jusqu’à ce que le tronc dérive à nouveau. Il était désormais inerte, et de grands bouillons blanc s’échappaient des impacts, là où l’écorce avait sauté.

« Je crois qu’on est bel et bien la cible de ces bestioles et non le rafiot ! », fit-elle à l’adresse des deux autres encore présents. Elle n’avait pas le temps de remercier son ange gardien là haut pour le moment.


Nelly Bricks



Nelly pagayait en zieutant les mouvements de Pedge, veillant à ce qu’elle prenne le même rythme pour que l’embarcation ne commence pas à dériver d’un côté ou de l’autre par manque de coordination.

Elle aussi n’était pas très rassurée par les troncs qui les suivaient. C’était beaucoup trop gros pour n’être que des souches inertes. C’est comme si un beau diable invisible leur souriait hypocritement de toutes ses rangées de dents pour leur préparer le clou du spectacle. D’ailleurs, SuperFord s’égosilla bientôt pour leur dire que les méchants allaient à l’abordage. Nelly eut soudainement envie de rire en l’entendant dire ce fameux “Il nous encerclent ! Tenez-vous prêtes ! Ils vont attaquer !”.
Dans son esprit, elle pensa qu’il avait de la chance de pas être le gardien d’une maternelle où il aurait fait paniquer inutilement tout le monde en un : ”AH ! Y’A LE FEU, ON VA MOURIR, AHHHHHHHHH !. Cette scène avait été joué par Schwarzenegger dans elle ne savait plus trop quel film. C’était d’un comique, on lui mettait un oeil noir et on avait la version Atlantis.

Bon, il allait falloir se défendre, le coeur de Nelly bondit soudainement dans sa poitrine lorsqu’elle vit la kiné s’envoler jusqu’au plafond. La petite espagnole prit immédiatement son arme d’une main valide pour pointer la liane mais ne tira pas, en plus elle gardait de l’autre une pagaie qui faillit s’envoler sous l’assaut d’un tronc.
Ce fût le début des ennuis et Nelly agrippa la rame des deux mains pour la disputer à la chose et essayer de la conserver. Désolé Natasha, place aux priorités ! SuperFord était en train de gueuler quelque chose mais, sur le coup, elle ne l’écoutait pas, elle cherchait à se libérer d’une main pour pouvoir transformer ce tronc en gruyère.

Elle vit un bras passer au-dessus d’elle et un grand soupir accompagna cette ingérence. Ah, là, il pouvait rêver tout haut ! La solidarité, c’est bien. Mais c’est mieux une solidarité intelligente !

« Hé !!!!! Mais il est à moi celui-là, pas touche !!! A chacun sa bestiole ! » S’écria-t-elle en refusant son aide et en gardant la pagaie dans les mains.

Bon, c’est bien gentil de vouloir être le chef et diriger l’équipe, mais s’il ne faisait pas confiance en ses soldats pour gérer les assauts des bestioles ça ne marcherait pas longtemps. Il peut pas tout faire, super-schwarzy. On commande et on se bat. Mais on va pas commander, se battre, et aussi se battre à la place des trois autres. Nelly n’aimait pas du tout qu’on la materne. C’était insultant.
Alors elle ne s’offusqua pas ouvertement, surtout avec la situation actuelle, mais elle comptait bien régler son problème seule. Et pour ça ? Rien de mieux que l’humour !
Elle imita la phrase culte du “C’est parce que j’suis black, c’est ça ?!?” en un magnifique :

« C’est parce que j’suis petite, c’est ça ?!? » Et avec l’accent qui allait avec, du grand art. Elle le fixa : « Tiens, regarde ! »

Bon, ça lui plaisait pas trop de tirer à souhait sur des créatures mais la compassion se limitait à son appréciation de la chaîne alimentaire. Là, sa bestiole voulait la manger alors elle n’allait pas lui laisser le loisir. Nelly se pencha légèrement en arrière pour permettre de ceinturer la pagaie à l’aide de ses jambes et y porter tout son poids : une forme de levier pour coincer le manche entre elle et le pneumatique qui se pinça.
Là, elle prit son MP5 des deux mains, y retira la sécurité pour le mode de tir auto, laser sur la partie la plus grosse et la plus visible du tronc et :

PA-PA-PAM, PA-PA-PAM.

Les balles claquèrent sur la surface de l’eau. Là aussi, une partie du tronc se désagréagea avec une étrange nappe blanche formant une auréole autour du corps. La chose s’agita sous les impacts, laissant douter un instant Nelly sur ses deux prochaines rafales, puis il s’immobilisa finalement. Le pistolet incapacitant était une bonne idée mais sur terre. SUR TERREUUUUU !
C’est pas pour rien que les Anciens avaient pu échapper à la destruction en noyant la cité au fond de l’océan. Première astuce contre l’armement Wraith : l’eau dissipe la charge plasma avec la profondeur. Donc une charge incapacitante sur une cible mobile entourée d’eau, Nelly n’avait spécialement envie d’essayer.

« Je crois aussi ! Et ils sont joueurs... » Répondit-elle à Pedge pour confirmer ses soupçons. « D’autres arrivent ! »

La petite espagnole s’était assurée d’avoir mis sa rame au fond du pneumatique. Elle chercha un équilibre plus sûr, se plaçant en position de tir sur son flanc du navire puis chercha les autres cibles. Si elles approchaient de trop, Nelly n’hésiterait pas à faire feu, le temps de s’organiser pour récupérer Natasha.

La faune/flore

En effet… Il y en avait d’autre qui arrivaient, mais morts. Sur les quatre “Croco-tronc” ou “Aligatortronc”, il ne restait que des corps inertes sur la surface.
  • Le premier ayant été tué par le venin de la nouvelle copine de Natasha et Ford… D'ailleurs, le corps était devenu entièrement noir, comme recouvert d’une toile d’araignée disgracieuse et violacée.
  • Le second par les tir du sous-lieutenant Allen, le corps était brisée en deux, avec un liquide blanc autour, les plus avisés verrons même des organes tout aussi blanchâtres s’y échapper.
  • Le troisième par les tirs du soldat Bricks, le corps étant en meilleur cependant, sauf concernant la tête qui était percée et complètement explosée.
  • Le quatrième tué par Ford qui menaçait d’emporter la palme d’Allen, celui-ci avait coulée dans l’eau


Étrangement, l’eau devenu calme et il n’eut plus aucun autre bruit… La serliane, remonta la tête vers Natasha, pour l’observer de long et en large en secouant un peu ses anneaux, pour la faire bouger doucement… Puis, il eut des bruits graves… D’autres troncs arrivèrent vers les corps flottants, pour les emporter dans l’eau, (sauf celui empoisonné) et au vu du liquide visqueux et blancs, ils n’étaient pas en train de les enterrer.
La serliane, descendit avec Natasha, la déposant délicatement, mais resta enroulé autour d’elle, déposant le résidu de son corps, sur le canot, qui tanga un peu sous cette charge nouvelle de la femme et de la serliane. Même si l’animal était bien plus léger que ce qu'on pouvait l'imaginer. La jeune femme, l'avait presque en totalité autour d’elle, dans une ceinture… le poids estimé ne dépassait pas les dix kilos.
La serliane, semblait observer avec méfiance, les armes que tenaient encore les militaires en mains… La belle couleur de l’animal vert émeraude était passé au noir.

Un nouveau groupe de troncs arriva pour le festin et immédiatement la serliane se dressa en feulant de son bruit fracassant. Chassant les petits curieux. Comme satisfaite d’elle, elle émit un son cristallin qui aurait pu être de la ronchonnerie. Cependant, elle ne voulait pas lâcher Natasha, comme si elle désirait encore la protéger, son regard allait sur Ford, attendant quelque chose de sa part.

Un œil avisé, pouvait voir que sur la droite, il y avait une ouverture d’une immense salle sans porte et une lumière s'échappait plus colorée… Il fallait pagayer encore cinq minutes ou plus, pour s’engouffrer dans le couloir et attendre l’endroit.

Nastasha Avalon


Natasha sentit le corps de la serliane se contracter et frémir en réaction aux détonations. Fort heureusement, elle ne la lâcha pas malgré la surprise et les eaux devinrent subitement calme alors que les cadavres des créatures continuaient à flotter en répandant un liquide blanchâtre derrière elles. La kiné eu un pincement au coeur en voyant le massacre, elle n’aimait pas particulièrement voir les animaux souffrir mais c’était eux ou son groupe et elle choisissait les siens sans hésiter. Tout à coup, il y eu du mouvement et les copains troncs rappliquèrent pour… oh… beurk.

La serliane se mit à tanguer et Natasha resserra ses mains autour du corps de sa nouvelle amie pour raffermir sa prise, pas du tout rassurée par les mouvements. Elle comprit cependant que la serliane était en train de la faire redescendre vers le canot et elle poussa un soupir de soulagement : si sa protectrice retournait vers le bas c’est que le danger était passé. Elle chancela en retrouvant pied avec le canot instable et lança un “coucou c’est moi” qui se voulait enjoué mais son expression inquiète la trahissait.


« Tout le monde va bien ?»
« Tout va bien de mon côté. Je n’en dirai pas autant de ma pagaie », fit la militaire en se penchant pour récupérer le manche désormais veuf.
« Ca va aussi. » Ajouta Nelly.
« J’en ai récupéré une en bon état grâce à notre amie. »
La serliane s’était décrochée du plafond et s’était enroulée autour d’elle, observant tour à tour les autres et semblant porter une attention toute particulière à leurs armes. La couleur noire qu’avait prit l’animal ne lui plaisait pas du tout, c’est comme s’il s’était mit en mode armure défensive autour d’elle. Qu’avait-elle bien pu faire pour mériter une telle protection de sa part ? La rouquine caressa prudemment son corps pour essayer de l’apaiser. L’animal lui pesait lourd l’air de rien, heureusement que son sac se trouvait dans le canot et pas sur ses épaules.

« Tout va bien ma grande… merci pour ton aide » lui murmura t-elle.


Aiden Ford


Et soudain le silence et le calme : les bestioles étaient mortes, certaines par balles et au moins une par le venin de la serliane. Les cadavres des alligatroncs ne restèrent pas longtemps libres de flotter. En effet d’autres troncs s’approchèrent comme si on allait repartir pour un deuxième round. Je tins mon arme prête mais c’est leur camarades qui les intéressaient, enfin sauf celui empoisonné par notre amies végéreptilienne ! D’ailleurs elle déposa Avalon avec délicatesse et douceur. Elle feula, on peut dire feula je crois ! Quand des petits troncs curieux firent mine de nous approcher, ces derniers en eurent la peur de leur vie. Cependant notre charmante amie était toujours enroulée autour d’Avalon. Elle regardait tout le monde mais me fixa un moment avec un air de dire “bon qu’est-ce que je fais ? Je posais mon arme et levai les mains !

« Tranquille ma grande ! On se calme ! Allen ! Bricks ! On pose son arme et on s’asseoit ! Je vous donne un ordre ! Pas une demande ! Pas le choix de faire ou pas ! Bricks ? C’est clair j’espères ! Encore une signe de désobéissance comme ça et je vous jure qu’on va en entendre parler sur Terre ! Quand je dis vous lâchez ça et vous tirez ! Vous faites exactement ce que je vous dis ! »


_________________
Aiden Ford Theme:
 





Médailles:
 


DC : Herakles Coeur de Thaïr
Revenir en haut Aller en bas
Lun 6 Nov - 22:26
avatar
√ Arrivée le : 16/04/2017
√ Messages : 274

Dossier Top Secret
√ Age: 31
√ Nationalité: États-Unis États-Unis
√ Gêne: Inoculation
Voir le profil de l'utilisateur
Nastasha Avalon



Natasha lança un regard sidéré en direction de Ford. Elle avait probablement loupé quelque chose depuis son perchoir là-haut qui expliquait la scène mais cette manière de leur parler… le militaire dans tout son cliché... cela dit, on pouvait dire des choses peu sympathiques quand on avait peur et il était clair que la serliane était plutôt impressionnante dans son genre. Quand on savait ce que son poison avait fait subir au tronc...
Elle se tint en retrait, encore choquée par tout ce qui lui était arrivée et peu désireuse d’intervenir dans une situation qui ne la concernait pas directement. La hiérarchie militaire ça n’avait jamais été son truc, elle accordait trop d’importance à la liberté de penser et d’être. La serliane, ça c’était un “problème” qu’elle pouvait gérer, alors elle continua à la câliner en essayant de calmer les battements de son coeur affolé.



Aiden Ford

Je reviendrais sur les problèmes de disciplines de Bricks une fois Avalon libérée, délivrée ! Cette chanson j’vous jures ! Je sors une barre chocolatée de ma poche et en tend un morceau à la serliane !

« Tiens c’est pour toi ! Merci de ton aide ! Tu peux reprendre tes couleurs et nous laisser reprendre la route, merci ?»

Nastasha Avalon


Natasha lança un regard catastrophé en direction de Ford, envisageant un instant d’intercepter la sucrerie. Un certain nombre d’animaux terriens ne supportaient pas le chocolat mais dans le cas d’une créature en grande partie composée de bois… comment savoir quels effets ce genre de chose allait impacter sur son organisme ?

- Vous allez la rendre malade !

C’est qu’elle s’y était attachée à sa petite serliane l’air de rien, elle n’avait pas envie de la voir souffrir. Mais le mal était fait, la sucrerie était trop proche et compte tenu de la tension de la serliane, comment savoir comment elle réagirait si Natasha faisait mine de repousser la main de Ford et, donc, de déclarer en un sens qu’il représentait une menace ? Pinçant les lèvres, la rouquine se résigna donc à ne pas intervenir et laissa faire les choses.

La faune/flore


Les caresses de Natasha firent virer le noir a une teinte plus claire mais sans pour autant calmer la serliane qui fixait de son regard clair Ford (car oui les serlianes ont des pupilles rondes comme les couleuvres et bleue… du moins celle-ci).

Dès que les armes furent rangées ou déposées à terre, l’animal jugea que le danger était totalement parti. Elle resta cependant enroulée autour de la Kiné. Le don de Ford, d’une barre chocolatée semblait surprendre la serliane, qui tourna la tête d’un air interrogateur vers Natasha et se mit à émettre des sons cristallins très doux et tout autant mélodieux. Il fallut attendre un petit peu, avant que celle-ci, enroule sa queue sur la barre de confiserie, pour la sentir et reculer la tête en sortant la langue d’un air de dégoût. L’odeur ne semblait pas lui plaire, par contre, en redressant son corps, vers les mouvements de l’eau agité par les tronc-croco...Elle y lança la barre, tout en se levant, pour voir la réaction des autres animaux. Le résultat ne se fit pas attendre les troncs se jetèrent sur la barre pour la happer déclenchant une bagarre générale entre les troncs.

La serliane semblait être secoué de spasmes similaires à des rires et les sons cristallins étaient plus saccadés. La tête de la créature revenue vers Natasha, s’enroulant (pour la partie haute) autour de ses épaules posant sa tête sur la tête de la jeune femme. Observant les humains. Par moment, elle semblait commenter ce qui se passait en “parlant” avec ces sons cristallins, essayant de communiquer avec la rouquine. Elle reprit ses couleurs vives.


Pedge Allen


Pedge n’avait pas envie de mettre en rogne la Serliane, aussi fit-elle comme son officier demandait et elle rangea son arme, la repassant en bandoulière dans son dos. Dans l’affaire, elle avait perdu sa pagaie, broyée en plusieurs morceaux par le tronc d’arbre vivant. Néanmoins, elle avait autre chose à faire que de pagayer pour le moment. Il y avait toujours cette liane vivante dans le canot, et elle tenait Avalon, mais plutôt de façon protectrice. Néanmoins, ses couleurs ne suggéraient rien de bon, et Ford tenta de l’acheter avec une confiserie. Pourquoi pas. Le fait de ranger les armes lui rendit des couleurs moins agressives, signe qu’elle les prenait pour une menace. C’était un problème qu’il allait falloir gérer car Pedge commençait à se dire que malheureusement, leurs armes serviraient encore. Finalement, la bestiole balança dans l’eau son présent, et cela la fit… rire. On aurait vraiment dit qu’elle riait de voir les troncs se jeter sur le morceau de chocolat. C’était déroutant, et cela dénotait d’une certaine intelligence, mais au moins cela lui ramena des couleurs plus amicales, selon les standards en vigueur chez les Serlianes. Il y avait de la tension entre Bricks et Ford, et elle ne savait pas trop pourquoi parce qu’elle était occupée à se défendre sur le rafiot pour surveiller les faits et gestes de chacun. D’un côté, cela ne la regardait pas.

Nastasha Avalon


La serliane reprit ses jolies couleurs lorsque les armes furent baissées mais ne repartit pas pour autant, il fallait croire qu’elle se sentait bien sur son nouveau perchoir. Elle observa le chocolat puis regarda Natasha comme si elle attendait une réponse de sa part.

- Tu peux y goûter si tu veux, répondit la kiné d’une voix calme. A défaut d’approuver le geste de Ford, elle voulait au moins faire comprendre à l’animal que le soldat était un ami qui ne lui voulait pas de mal. Apparemment, la serliane semblait se préoccuper de son avis alors, à défaut de parler la même langue, elle espéra avoir réussi à lui transmettre le message par la douceur de sa voix.
Elle n’était pas spécialisée dans les langues étrangères, encore moins dans les langages et comportements animaux… pas simple de communiquer et de se comprendre mutuellement dans ces conditions.

Au final, la curiosité du l’emporter puisque la serliane enroula sa queue autour de la barre de confiserie et l’approcha de son visage. Ce qu’elle vit ou senti ne lui plut pas et elle lança le chocolat par dessus bord et braqua son regard sur les troncs qui se mirent à se battre pour s’en emparer. Natasha écarquilla les yeux en réalisant que le corps de la serliane était parcouru de soubresaut comme si elle… riait ? Alors non seulement ce serpent éprouvait des émotions, parlait une langue qui, Natasha en aurait mit la main au feu, possédait des règles de construction logiques et définies comme celles des humains, mais en plus il savait faire des blagues. A ce rythme, qui sait si elle n’allait pas bientôt apprendre que sa nouvelle compagne de route savait faire sauter des crêpes ? L’amusement de la serliane étant communicatif et Natasha se mit à rire silencieusement, son état de nerfs l’y aidant. Elle se trouvait au milieu d’un bassin rempli de prédateurs et un serpent qui, pour elle ne savait quelle raison obscure s’était attaché à elle au point de risquer sa vie pour la protéger, était en train de se foutre ouvertement de la gueule des animaux qui avaient essayé de les dévorer quelques minutes plus tôt. La situation était totalement surréaliste !

Sentant ses jambes flancher, la kiné préféra se rassoir doucement dans le canot pour éviter de s’écrouler et déposa la pagaie à côté d’elle. Il fallait qu’elle se ressaisisse, l’expédition commençait à peine ! Elle fouilla dans son sac et en sortit une gourde d’eau dont elle avala quelque gorgée avant d’atrapper une barre de céréale. Elle commençait à l’ouvrir lorsqu’elle lança un regard soupçonneux vers la serliane.


- N’y pense même pas ma grande !

La Serliane émeraude



Dès que Natasha sortie la barre de céréale, immédiatement l'animal s’était dressé pour essayer de s’enrouler autour. La blague avait l’air de lui avoir plus… Cependant elle stoppa son mouvement quand sa copine humaine parla. Une nouvelle fois, elle tourna la tête vers elle et essaya de communiquer en reprenant les vibrations sonores de la voix humaine. Dans les sonorités, il semblait de plus en plus évident que cela n’était pas que des sons dit au hasard, mais que petit à petit l’oreille s’y habituent, il y avait des mots, mais cela n’était pas une langue connue par les aventuriers. Faut dire qu’on n’entend pas souvent ce langage, d'habitude ont le lis.

En tout cas, la serliane secoua sa tête pour se repositionner sur son épaule tout en regardant le petit manège entre Ford et l’autre petit humaine. Elle tapota sur l’épaule de Natasha, pour lui montrer la scène.


Aiden Ford


Bon, je lui laissait le bout de chocolat incrustée de cacahuètes ! Et je me tournais vers Bricks :

« Dites-moi soldat Bricks ! Où est-il écrit dans le manuel que vous avez tout loisir de tutoyer votre officier supérieur ? Sous la ligne qui dit qu’un ordre direct sous le feu de l’ennemi peut être refusé ou contredit ? Quand je vous dit “lâchez ça et tirez au paralysant !” Vous n’avez pas à décider dans votre tête si ces ordres méritent d’être suivis ou non ! Il ne vous est pas venu à l’esprit que dans cette situation, les balles réelles sont un risque de dommages collatéraux supplémentaires. Si vous avez été capable de tirer sur nos assaillant avec un petit projectile, il ne me sembles pas fou d'imaginer que vous auriez réussi aussi avec l’armement Wraith ! Au lieu de porter la main sur un officier et de montrer des signes de mutinerie ou à tout le moins d'indiscipline crasse ! »

Bon au moins j’avais éviter le “Ducon” de Renégat ! Pour moi c’est un exploit !

« Permission de parler librement demandée, mon lieutenant. » Répondit Nelly de manière neutre.

Oh la ! Le soldat veut me répondre, sortez les muletas ! « Accordée si vous gardez le respect et le ton mesuré qui convient dans l’armée ! »

Nelly eut une soudaine envie de rire. Elle voyait une scène d’une petite d’un mètre soixante en train de hurler et d’insulter un officier qui faisait deux fois sa taille et trois fois son poids. Pour un peu il serait capable de battre le record de lancé de poids en la chopant par les pieds. C’était quand même réducteur mais comique comme situation.

« Lieutenant, le plasma Wraith se dissipe dans l’eau avec la profondeur. Je ne connais pas l’impact d’une utilisation en surface sur un corps mobile et j’étais en prise directe avec l’ennemi. J’ai contrôlé ma ligne de tir, répondu à la menace, défendu mon coin et répondu à l’ordre malgré la différence de méthode. »

Elle dégrafa son MP5. « En revanche, lieutenant, je suis un petit bout de femme qui a passé les tests d’admission physique lors de ma mutation. Je suis apte de mes aptitudes martiales et si vous en doutez pour vous substituer, physiquement, au beau milieu du conflit, je retourne sur Atlantis préparer ma défense pour la cour martiale. »
Elle haussa les épaules en toute conclusion. « Le tutoiement est involontaire au cours de l’action et ne reflète pas un manquement au respect du grade. »

Je souriais : enfin un discours normal ! Elle ne manquait pas de bons arguments, toutes les têtes brûlées en ont mais qui écrit aux familles quand les têtes brûlées se crament ? Ce sont les officiers de terrains ! Bon rassurons le soldat Bricks : « Vous m’avez entendu mettre en doute votre capacité physique ? L’ai-je fait avec la Sous-lieutenant Allen ? Non ! Femme ou homme je m’en moque ! Mon officier supérieur est une femme, Allen à été mon sous-officier commandant, alors femme ou pas là n’est pas la question je vous ai dis de prendre une arme pour tirer, mon intervention n’était qu’un soutien pour vous libérer les mains et ne pas perdre la pagaie, et accessoirement que ce soit un autre qui vous donne une cible efficace ! Je l’aurais fait mais vous étiez devant mon arme ! Et en tirant sur les bestioles même une fois sur trois dans l’eau au moins on ne gâches pas des balles qui s’en vont dans tous les sens ! Avez-vous compris votre méprise ? Si je comptes sur vous j’espères que vous suivrez mes ordres la prochaine fois ! Un ordre ne veut pas dire que vous n’êtes pas capable mais qu’il y a un plan à suivre pour fonctionner en équipe pas chacun selon son bon vouloir, moi pas plus qu’un autre ! Sans vous mes capacités ne servent à rien ! »
Bon sang ce discours ! Je me prends pour un Patton de l’espace, moi ! « Disons que c’est un coup pour rien ! Nous sommes sur la même longueur d’ondes, Bricks ? Et ici je suis le plus qualifié en survie dans la nature sauvage aussi délirante soit-elle ! »

Nelly bugua complètement sous le flot de parole. Ils perdaient tous les deux du temps pour rien mais Nelly n’avait pas envie de lâcher l’affaire. Elle replaça son MP5 et l’ajusta devant elle.
« Négatif lieutenant. Chacun sa place et vous avez entamé la mienne. Ce sont vos actes qui remplacent vos propos. Mais je vais faire un effort le temps que nous soyons rentré pour régler le différend. » Elle zieuta Natasha et eut un léger sourire, elle se pencha vers elle : « Je te dois le paquet de cookies au retour. »

« On le mangera ensemble », chuchota Natasha avec un petit sourire. Une manière de lui faire comprendre qu’elle compatissait.

Elle lâche pas l’affaire la petite, bon reste l’arbitre : Allen !
« Et vous Allen ? Si vous commandiez et que je décide de faire selon mon idée au lieu de suivre vos ordres vous diriez quoi ? », bon et ensuite on va voir ce que réserve ce couloir !

Pedge Allen


En fait, si. Cela la regardait puisqu’on lui demandait son avis. Elle avait écouté, forcément, les échanges entre les deux militaires. Difficile de faire comme-si de rien n’était dans un canot pneumatique de quatre places. Le comportement de Nelly était bluffant. Ok, Pedge l’avait déjà vu en mission par le passé, trouvant que son attitude tranchait fortement avec ses gamineries habituelles, mais là, elle se révélait vraiment comme une adulte pleine et entière. Quoiqu’il en soit, le lieutenant ne lui demandait pas son avis sur le différend qui l’opposait à Nelly, mais plutôt sur ce qu’elle ferait si elle était dans ce genre de situation avec son ou sa subordonné(e). Etait-ce une forme de test pour voir si elle méritait ses galons ou quelquechose comme ça ? Elle ne pouvait pas s’empêcher de se sentir en évaluation constante.

Elle soupira. Elle n’avait pas envie de se mêler d’un problème de hiérarchie alors qu’ils dérivaient sur un radeau au milieu d’une eau verte qui recelait mille et un dangers. Mais bon, manifestement, il fallait trancher ici et maintenant, donc soit. Pedge n’était pas connue pour avoir une langue de bois, et la question était simple.

« Qu’il faut respecter la ligne de commandement Lieutenant. ». Elle ne compléta pas, peu désireuse de rentrer dans les considérations des uns et des autres. C’était la base de toute structure militaire que de respecter l’échelon au-dessus, sinon c’était la porte ouverte à tout et n’importe quoi. Des hommes fonctionnaient en société par le biais d’un cadre strict qui dispensait les règles, les obligations, les droits et les devoirs de chacun et tout le monde devait tenir sa place sous peine d’être expulsé de cette société, en l'occurrence ici, de l’armée. C’était comme ça et pas autrement. Certes, cela faisait passer les bleus pour du bétail prompt qu’à exécuter, mais les soldats du rang étaient des exécutants purs et durs, que ça leur plaisent ou non. S’ils voulaient commander, ils prenaient du grade, mais qu’importe celui-ci, il y aura toujours quelqu’un au-dessus pour décider à la fin. Monter permet juste une plus grande autonomie. Pedge n’avait pas été témoin directement de la scène entre Nelly et Ford. Les arguments de la jeune femme tenaient la route, et Ford devait les prendre en considération, mais Bricks devaient aussi tenir son rang.

Les situations sur Atlantis étaient souvent exceptionnelles, et elles permettaient à n’importe qui de prendre des décisions, au-delà de la chaîne de commandement, quand elles se présentaient. Cependant, en cas d’ordre direct, et sauf danger létal, on ne devait pas les discuter, et obéir. De toute façon, ce serait toujours la faute de celui qui avait refusé un ordre, dans la plus pure tradition militaire. C’était pour cela qu’elle fermait sa gueule et qu’elle n’ajoutait pas que Bricks avait peut-être cru faire bien, qu’elle avait peut-être jugé que la situation était plus appropriée selon la façon dont elle l’avait géré, et qu’il serait peut-être temps d’avancer et de faire quelque chose de constructif. Néanmoins, elle comprenait que l’officier en charge règle le problème de discipline et d’autorité avec son subordonné, même si la prendre à partie ne résolvait toujours pas ce problème de leadership qu’il avait du mal à mettre en avant, et ce, depuis Renégat. Bref, Pedge avait plus le sentiment que Nelly se sentait materner, et qu’elle essayait de montrer qu’elle était compétente. Elle espérait que la jeune femme tienne son rang à l’avenir, et que l’officier prendrait en compte qu’il ne pouvait pas palier à toutes les situations tout seul malgré ses capacités hors du communs.



Nastasha Avalon



Sa nouvelle ceinture 2.0 tenta d’attirer son attention sur ce qu’il se passait à côté. En même temps, il était plutôt difficile d’ignorer une engueulade lorsqu’elle se passait à moins de deux mètres de vous. Apparemment, Bricks avait ignoré un ordre et cela ne plaisait au plus gradé qui, dépassé par les évènements, se tournait vers la troisième soldate pour trancher. Natasha grignota sa barre de céréale d’un air blasé. Bonjour l’ambiance ! Est-ce que ça se passait mieux dans l’autre groupe ? Elle finit par soupirer et tourna son regard qui s’était voulu fuyant jusqu’à présent vers le reste du groupe. Elle n’était pas une militaire, elle ne se sentait pas légitime pour prendre la parole dans cette conversation et la situation commençait à lui taper sur le système.

-Juste comme ça, lança t-elle assez fort pour être entendue par tous et sans cacher son agacement, Je sais pas si vous avez remarqué mais on est un peu sur un canot pneumatique instable qui flotte au dessus d’un troupeau de bestioles qui veulent notre peau alors si on pouvait attendre d’avoir regagné la “sécurité” de la terre ferme pour les éventuels règlements de compte ce serait pas mal.

En cas de refus, elle était prête à prendre la rame et à gérer ça seule, par contre elle ne manquerait pas de faire remarquer à Ford ce qu’elle pensait de son ordre de priorité : engueuler un soldat avant de penser à mettre le reste du groupe en sécurité, sérieusement ?!
Natasha tendit un petit carré de sa barre de céréale à la serliane. Au moins il y en avait une qui s’amuserait un peu… le serpent était la seule chose qui lui donnait envie de sourire actuellement.
Elle remarqua la caméra qui était restée au fond du canot depuis le début de l’attaque. S’il n’y avait pas eu de prise d’image, le son, lui avait bien dû être enregistré puisque l’objet était allumé lorsqu’il lui avait échappé des mains. Les botanistes allaient s’amuser en regardant ça.


La faune/flore


La serliane hocha la tête sèchement comme pour dire « oui voilà » aux propos de Natasha, avec un son cristallin. À dire vrai, elle n’avait rien compris à ce qu’elle disait, mais, le ton lui signifiait qu’elle disait aux autres de se taire et d’avancer. Le petit bout de barre chocolaté que lui tendait Natasha, fut immédiatement prit avec sa queue. La serliane déroula son corps, pour agiter le morceau au-dessus de l’eau.

Aucune réaction. Intriguée, elle se déroula vers le haut pour toiser de haut l’onde. Elle se mit à émettre un bruit étrange ressemblant à du « tactactactactactactactac »… Aucune réaction. La créature semblait soupirer…
La Serliane, déposa le bout de chocolat, pour prendre la pagaie de Natasha et recommençant son bruit mais en tapant l’eau avec l’objet. Cela attira l’attention d’un tronc.

Aussitôt elle remit la pagaie et agita le morceau au-dessus de l’eau. Le tronc, alla à cet endroit, attendant. À force de le secouer, le tronc se dressa hors de l’eau pour faire claquer sa mâchoire… mais retomba sur le dos lourdement, éclaboussant le militaire le plus proche. Cette réaction fit « rire » la serliane , qui recommença mais envoya le bout de la barre de céréale, plus loin sur un autre tronc… Cela se transforma à 4 mètres d’eux en jeu de lutte gréco-romaine entre troncs, qui voulaient attraper le bout de nourriture. À la fin, cela ressemblait plus à un amas difforme qu'à autre chose. La serliane se marra d’autant plus en secouant la tête tout en émettant des bruits cristallins et des sifflements… commentait-elle le match ? Elle se tourna vers Natasha et secoua la tête en soubresauts.


Nelly Bricks



Natasha avait mis dans le mille avec sa remarque et c’est justement l’une des situations qui avait le don d’énerver Nelly : paraître stupide, faire partie d’une situation décrédibilisante. Papoter à outrance pour définir qui à raison et qui à tort, cette vaste farce. Le discours de l’officier, elle aurait été bien incapable de le répéter tellement cela avait été long. Et la jeune femme avouait qu’elle n’acceptait pas de fermer la discussion par la complète soumission du “chef, oui chef”. Merde quoi, il lui était quasiment passé dessus quand elle s'apprêtait à répondre à la menace. Il faisait le boulot à sa place et elle devait fermer sa gueule ? Utiliser son cerveau semblait être proscrit, seule chose qu’elle avait bien retenue de sa fanfaronnade d’officier : il fallait obéir bêtement à cet homme, comme un pantin, une chose, sans marge de manoeuvre. Super, la grande classe.
Bon. Nelly regretta amèrement de s’être expliquée. Est-ce que ça aurait été utile à part ajouter de l’instable à cette situation ubuesque ? Elle aurait dû se taire et passer pour une débile.

Transformer Pedge en arbitre c’était déjà pas mal. Mais être littéralement tourné en ridicule par cette maudite discussion sur le canot, c’était la goutte. Quelle magnifique image du militaire ils donnaient là, à se houspiller pendant que la civile, en fin de compte, avait été uniquement soutenue et secourue par une créature inconnue. Une chance qu’elle se comportait en alliée. Eux, ils avaient juste oublié de faire leur boulot au passage et Nelly regrettait d’en être en partie responsable. La plus grosse, de partie responsable, se trouvant face à elle.

Et puis, en son for intérieur, la réponse parfaitement cadrée de Pedge lui avait piqué le coeur. Bien sûr, elle avait répondu en une phrase, elle avait fait ça comme une pro pour éviter d’étendre ce débat stérile. Mais bon sang, ce que ça pouvait faire mal de ne pas être soutenu par les gens qu’on affectionne. Et qu’est-ce qu’elle aurait dû dire d’autre de toute façon ? Là, SuperFord allait juste jubiler du pouvoir que lui offrait son grade.

Exécute et ferme ta gueule en somme. Bon, et bien c’est ce qu’elle allait faire. Mais ça ne l’empêchait pas de bouillir et de haïr mortellement cet homme qui se targuait d’être officier. Heureusement qu’il n’avait pas la capacité de lire dans l’esprit dans sa liste de super pouvoir parce qu’il aurait été étonné de sa créativité en terme de nom d’oiseau. Se taire, c’était dans ses cordes. Le fusiller d’un regard mauvais, elle ne pourrait pas s’en empêcher en revanche.

Nelly se mura dans le silence et reprit sa place, amère, sans rien ajouter. Elle avait visiblement parlé pour toute la mission, bienvenue le jeu du silence. Rapidement, elle récupéra la pagaie qu’elle avait rangé pour se préparer et s'exécuter comme un bon soldat décérébré. Elle regarda droit devant soi en attendant les consignes. Elle aurait bien eu l’envie de dire que c’était le bon moment de s’éloigner puisque la nouvelle amie de Natasha leur faisait de belles diversions. Mais c’était pas son boulot, alors elle resta silencieuse.

De la bouderie ?
Non, du tout. D’ailleurs, son esprit plein d’humour revint en force. Elle s’imaginait les diverses scènes que nous avions tous eu pour nos patrons exigeants. Un petit passage à travers une vitre. Là, par exemple, elle se voyait bien le foutre à la flotte et lui balancer quelques tirs plasma rien que pour vérifier si sa fameuse idée était bien la bonne. Vous voyez ? Une tite noyade horriblement accidentelle pour “l’orateur du canot de la jungle”. Ces petites choses là, pas sérieuses du tout, agréables à penser, et heureusement irréalisables, étaient tellement salvatrices pour l’esprit. Ces images eurent tôt fait d’étirer un sourire discret aux coins de ses lèvres alors qu’elle attendait les ordres comme le plus parfait des zombis.
Nelly n’avait peut-être plus l’indépendance de ses actes. Mais ça ne l’empêcherait pas de penser et de maudire joyeusement Ford de milles façons.

Aiden Ford


Et merde ! Hamilton, Eversman, Bricks ! Pourquoi donc les rebelles à l’autorité s’engageaient-ils dans l’armée ? Et surtout pourquoi on me les fourraient toujours dans les pattes ? Je suis sûre que l’espagnole reste sûr de son bon droit ! J’aurais pu insister mais pourquoi faire ? La crucifier en mettant en lumière son imprévoyance ? Pas une qui n’a réalisée ! On est sur un canot pneumatique, et tout le monde est debout, tout le monde tire à balle réelle et le seul qui pense au risque d’une rencontre entre un projectile brûlant et le plastique de notre embarcation passe pour un connard colérique ! Et que dire du fait que si la pagaie avait glissée d’entre ses jambes, le déséquilibre au moment du tir aurait eu des effets imprévisibles. Mais bon ! Passons, je suis pas là pour me faire aimer, sur ce point Avalon a raison on perd du temps !

Je pris le deuxième canot toujours compressé et le jetais à l’eau après avoir enlevé la goupille : ” Attention ! Restez assises ça va tanguer !”, je montais les deux pagaies en kit et les lançait dans le nouveau canot. On avait un couloir à longer et des salles, au moins une en tout cas, a visiter. On devrait se séparer et j’avais déjà mon idée puisque mes effectifs se défiaient de mon jugement !

” Allen ! Avalon, Bricks et vous prendrez le canot à deux pagaies ! Vous suivrez le couloir vers là où il aboutit. Moi je prends celui-ci et j’irais explorer la salle et les autres s’il s’en trouve ! Si vous aboutissez à un cul-de-sac alors vous pourrez me retrouver, mais prévenez-moi d’abord, histoire que je vous accueille sans un coup de feu malheureux ! Si vous trouvez autre chose, eh bien dites-le moi aussi je vous dirais quoi faire ! “

Les trois femmes seraient ensembles et pourraient s’épancher à loisirs sur Ford le tyran ! Et moi j’aurais pas à me faire chier à protéger des gens qui ne voulaient pas le comprendre !

// Major Frei ? Lieutenant Ford au rapport ! Avons essuyé attaque de créatures végétales, l’équipe s’en est bien tirée ! Avons découvert un couloir et des salles sur le chemin. Ai décidé de diviser le groupe : Allen prends la charge de Bricks et Avalon pour remonter le couloir. Moi je vais explorer les salles ! Message reçu ?//

// Négatif Lieutenant, je vous ai nommé chef de cette équipe ce n'est pas pour aller jouer cavalier seul de votre côté. Ordre de rester groupés quelques soient les circonstances.//

//A vos ordres Major ! Ford Terminé !//


Nastasha Avalon


Sa petite gueulante avait au moins eu l’effet de faire avancer les choses. Si ses compagnons de route voulaient se crêper le chignon ils étaient libre de le faire, elle n’avait pas d’avis sur qui avait raison ou tort puisqu’elle n’avait même pas assisté à ce qui avait provoqué la dite tension, mais il y avait un temps pour tout dans la vie et là ils étaient en danger de mort.

La serliane faisait une bonne diversion et Natasha songea à sacrifier une autre barre de céréale pour leur permettre d’avancer : pendant que les troncs se battaient pour s’emparer de la friandise ils n’attaquaient pas les rames. Alors qu’elle était en train de se faire cette réflexion, Ford annonça qu’il allait partir seul de son côté. Natasha lui lança un regard étonné du genre “t’es sérieux, mec ?”. C’était sa manière de les punir et de bouder ou il pensait vraiment que partir seul dans un environnement hostile était une bonne idée ? Elle ouvrit la bouche pour contester : tant pis, il n’allait pas aimer ça mais en tant que “médecin” de l’expédition il fallait qu’elle lui fasse remarquer que personne ne pourrait lui servir de soutien s’il se faisait attaquer ou mordre par une créature au venin foudroyant. Mais avant qu’elle puisse dire quoi que ce soit, Ford prit sa radio pour avertir Frei de sa décision. Par bonheur, cette dernière lui ordonna de rester avec l’équipe. La rouquine se sentit soulagée, elle n’aurait donc pas à verser de l’huile sur le feu en s’opposant à son “chef” de groupe. Merci major !


Aiden Ford


Tiens dans le genre exemple sur le réel ! Bricks pourrait apprécier le choix que j’ai de faire selon mon envie ! Bon ça change tout ! On va faire autrement alors !

” Bien ! Bon les ordres sont les ordres ! Bon Allen et Bricks vous montez dans le nouveau canot et vous prenez la tête ! On s’arrête devant la salle ! Avalon et Moi on reste ici et on vous suit, je gardes un oeil sur les alligatroncs. “

Pedge Allen


Pedge pensait qu’on avait touché le fond avec la remarque de Natasha sur le fait qu’il serait temps de se bouger les fesses. Tout comme Nelly, elle n’aimait pas passer pour une conne incompétente, pas plus qu’elle n’aimait laver son linge sale devant quelqu’un qui n’était pas de la partition militaire. Mais bon, c’était la méthode Ford, qu’elle trouvait toujours aussi… Elle n’en savait rien en fait, mais ça ne lui allait pas. Mais alors quand il commença à raconter qu’il allait diviser l’équipe numéro 2 en équipe 2bis et 2ter, c’était du grand n’importe quoi. Pedge fit les gros yeux alors qu’il prenait sa radio pour communiquer la chose. HEUREUSEMENT le Major refusa net. Sinon c’était parti pour une prise de position franche du sous lieutenant Allen, public ou pas public. Il y a des moments où il faut arrêter de faire le gamin, et mettre son égo de côté. C’était un officier merde ! On allait où là ??

Intérieurement, elle se promit d’aller le choper au retour de cette mission pour avoir une discussion franche avec lui sur ce qu’il attendait de la vie, parce que là, elle ne comprenait pas tout. Il recadrait Nelly, certes, à sa façon, il avait son soutien sur sa question et Monsieur prenait encore la mouche ? Mais c’était quoi son problème ? Il avait réglé le problème d’autorité, la mission pouvait repartir dans le bon sens ? Et là, il se foutait une balle dans le pied en voulant prendre le large comme un gosse, la queue entre les jambes, pour ne pas assumer son autorité ? Pedge ne le comprenait décidément pas et elle était en train de s’agacer prodigieusement tout comme ce fut le cas quand elle était de mission de concert avec l’amérindien. Qu’on lui donne une pagaie tout de suite qu’elle cogne du tronc ! Ca la défoulerait.

Non, la maîtresse en art de la dissimulation émotive resta de marbre, considérant son officier d’un œil torve. Il distribua de nouveaux ordres, et elle se retrouva dans le second rafiot avec Nelly pour passer en éclaireur.

« Ok, on avance. », fit Pedge en prenant place. Elle bifurqua vers la salle de droite.

Aiden Ford



Comme nous arrivions près de la salle en question, je me rendis compte que les espoirs de quitter les canots seraient déçus : De l’eau ! De la putain de flotte avec des murs pleins de plantes ! Mais bordel c’était quoi ce coin ! Si je tenais le savant fou qui a eu cette idée de jungle de cité, je te lui ferais passer l’envie de jouer avec l’adn et sa pelle et son seau ! Bon du coup ça va pas, on doit changer la disposition, bravo l’officier ! Tu perds la boule dès que tu dois commander. Tu dois vraiment faire quelque chose pour cette question de confiance en soi ! Rappelles-toi ton instructeur, lui, il devait pas se poser de questions existentielles ! Bon donc encore un changement de canot.

” Bricks et Avalon vous tenez l’arrière-garde ! Si le Docteur risque d’être grièvement blessée par ce qui se trouverait là-dedans et que nous sommes blessés ou inconscients Allen et moi, vous avez ordre formel de vous enfuir et d’appeler le Major et d’attendre les secours et/ou les renforts ! Bricks ! C’est compris ? Pas d’initiative si le groupe est réduit de moitié, on doit protéger les civils !”

Je regardais Allen puis : ” Allen vous et moi on prends l’avant-garde espacement de 2m entre les deux canots ! Ouvrez l’oeil ! Et on ne tire que sur signes clairs d’agressivité ! C’est nous les intrus, ici ! “

Après un moment de flottement où je passais du canot arrière au canot avant nous nous enfilâmes dans cette salle inondée à l’éclairage important mais bien flippant avec toutes les ombres renvoyées par les verdures des murs et du plafond !

Nastasha Avalon


Après tout ça, ils eurent la mauvaise surprise de noter que les couloirs et les pièces étaient envahis par l’eau. Pas moyen de mettre pied à terre, il allait falloir poursuivre l’exploration en canot.
Ford redistribua de nouveaux ordres et la kiné nota l’importance qu’il semblait accorder à sa vie comparé à celle des autres. Et ben… si elle ne se sentait pas protégée avec ça ! Intérieurement, l’idée d’abandonner ses alliés en cas d’attaque la faisait bondir mais elle comprenait l’intention : elle n’avait pas l'entraînement des soldats et n’était pas préparée à affronter le danger. Bien que, sa ceinture 2.0 changeait quelque peu la donne, on pouvait dire qu’elle était la mieux protégée du groupe en fin compte.


-Ok, se contenta t-elle de répondre.

Elle veilla donc à rester en arrière et interpella Nelly :

- Je connais un pâtissier qui vend des cookies du tonnerre au marché athosien, lança t-elle à demi-voix, espérant détendre un peu la tension générale. On pourra peut-être aller y faire un tour quand tout sera finit, histoire de manger un gâteau ou deux à la mémoire des troncs-de-la-mort-qui-tue.

Il n’en fallait pas plus pour faire démarrer Nelly. Elle se tourna légèrement pour lui répondre :

« Et comment ! J’en ai pas mangé depuis des siècles. »

Léger silence avant d’ajouter :

« Si ça chauffe, tu dois t’abriter derrière moi. »
Imaginez la différence de gabarit avec son nouvel ami ?
« Tu aurais le pouvoir de te plier en kit Ikea ? »
- Je vais essayer de me faire toute petite, sourit Natasha.
« Plus petite que moi, tu pourras jamais test ! »
Nelly soupira.
« Bon, sérieusement, tu restes bien derrière moi si ça chauffe et tu te places au centre du canot pour conserver l’équilibre. Autant faire plaisir à Monsieur Ford. Si jamais ça se corse et qu’on se retrouve à l’eau, tu t’accroches à moi et on reste ensemble quoiqu’il arrive. » Elle se retourna pour lui faire un clin d’oeil : « Le plan te va ? »
- Je peux aussi lâcher ma ceinture 2.0, elle est plutôt badass tu trouves pas ? Répondit Natasha en montrant la serliane enroulée autour d’elle.

Et merde. Avec Natasha, ça allait être dur de rester sérieuse. L’humour, c’était vraiment le dada de Nelly. La voir mettre en avant son nouvel ami ainsi cerné autour d’elle lui arracha un léger rire alors qu’elle continuait de surveiller les environs.
« Conserve-là pour tes séances de “pole dance & boa” pour les garçons. »
- Ouais, c’est l’outil drague indispensable.

_________________


Double compte : S. Caldwell, P. Sidney
Revenir en haut Aller en bas
Lun 6 Nov - 22:33
avatar
√ Arrivée le : 01/08/2015
√ Messages : 379
Voir le profil de l'utilisateur
Equipe 2 Naviguez en paix
Chronologie 18 octobre 2017



La salle était donc inondée de cette eau verte et étrange. Le fond semblait atteindre deux mètres de profondeur.
La salle était bien éclairée et il y avait des serliane un peu près partout avec d’autres éléments de la végétations, formant une forêt assez atypique sur le plafond et les murs. Contre-ceux-ci il avait des dômes constituer comme le premier tas à l’entrée. Dessus, trônait une petite machine active en forme de cylindre. D’autre était accrochées sur des amas de d’autres machines. Un écran imposant se trouvait au fond de la salle, il y avait des données en cours, des analyses qui échappaient aux aventuriers. Une sorte d’arbre était devant, relié au plafond par un cordon organique et vert. E même cordon semblait reliées aux différentes machines et à l’écran.

Il y avait de douces mélodies cristallines, les chants des serlianes. La mélodie n’avait rien de connues pour les aventuriers. Mais les chants étaient beaux, très relaxant.

La serliane de Natasha, observait autour d’elle et a de nombreuses reprises, les autres serlaine plus foncées, sortaient leurs têtes saluant dans des sons agréables l’autre serliane, qui les saluaient en retour.

Il eut un bruissement d’ailles et une boule de plume tricolore : blanc violet et rouge s’enroula autour su coup de la serlaine Émeraude, Le groupe put reconnaître sans peine un « yaya ». Il eut des sortes de ronronnement de la petite créature et elle câlina clairement la tête de la Serliane avec beaucoup de tendresse. Le serpent était tout aussi affectueux, enroulant une part de son corps, autour de la petite créature pour la serrer contre elle. Les couleurs étaient en train de changées, vibrant dans des teintes vertes irisées.

Le petit « yaya », se tourna vers les autres humains, les observant et de ses yeux verrons : l’un bleu ciel et l’autre ocre. Elle toisa la serliane, puis se montra en proclamant :
« Mymy ! Moi être Mymy ! Moi parler langue vous peu ! »

Soudainement, il eut une voix… une voix presque humaine qui s’échappait de l’arbre… l’arbre qui n’en était pas hin, puisque le corps végétal se tourna… Un buste d’homme au visage très fin comme un elfe les observait avec ses grands yeux jaunes. Tout le corps semblait constituer de plante. La créature nagea vers les canots, où on pouvait voir qu’elle avait le corps d’un poisson, mais tout aussi végétal. Une sorte de triton ou de sirène, puisque impossible de le sexer.

La voix parlait dans une langue inconnue et s’adressait aux deux autres animaux. La Serliane se détacha de Natasha pour se tendre au-dessus de l’eau et s’enrouler sur le bras de l’étrange ondine, créant un pont entre les deux. La serliane parlait de ses étranges sons, qui parfois semblait être des mots. Mymy était toujours dans les anneaux, mais proche de Natasha.
La sirène observa les canaux d’un air dédaigneux. Puis se mit à parler dans leur direction et en anglais.

« Vous avez l’intérêt d’Emeryan… surtout vous jeune femme rousse … Et aussi vous, jeune homme noir. Vous semblez savoir chanter juste…Même si votre chant est disgracieux comme tout terrien… Que faite vous ici ? La cité ne fous suffit plus ?»

En entendant la langue commune des terriens, Emeryan tourna la tête vers l’ondine et parla à nouveau… il eut un échange assez étrange. La serlaine était en train d’houspiller la sirène qui haussait les épaules en montrant les aventuriers d’un air méprisant. Finalement, la serliane détourna la tête comme pour bouder et siffla.

Mymy suivait l’échange tout en observant étrangement les humains…
« Emeryan pas content … Pas content que maitre n’est pas dit que lui parler langue de vous et pas avoir appris à lui » dit la petite boule de plume, qui alla sur le rebord du bateau. « Emeryan trouver pénible de pas comprendre Avalon ? Avalon ton nom à toi ? »

En effet, dans le discours de la Serliane, dans les sons mélodieux, chacun pouvait entendre, son noms… des noms, qu’avait dit Ford régulièrement. Après, Avalon était le mot qui revenait souvent. Le ton montait et la serliane prenaient des couleurs sombres cramoisie.

Finalement Mymy prit partis pour soutenir la serliane dans le débat. Autant, elle semblait parlée comme un enfant en anglais, mais dans cette autre langue, cela avait l’air très fluide. L’ondine, finissait par soupirer… Elle tendit la main vers une machine et le cordon végétal semblait s’illuminer comme un transfert de donnée. Et une aiguille alla se planter dans le haut de la tête de la serliane qui siffla de déplaisir, mais se laissa faire. Cela durant quelques minutes. L’écran derrière affichait un alphabet en anglais… Un esprit logique, déduirait qu’il y avait un transfert de données, ou un apprentissage rapide.

« Voilà… tu es content ? »
La serliane siffla en hochant la tête d’un air mécontent et alla s’entourer autour de Natasha.
« Tu me comprends ? » Le son était toujours aussi cristallin, mais les mots étranges, était devenu de l’anglais. Cela pouvait être difficile à comprendre par moment.

« Oui, elle comprendre toi parler sa langue ! » Lança Mymy amusée, elle eut un petit regard de la serliane qui semblait attendre une réaction de Natasha.

-----------

  • Jusqu’à Lundi 13 Novembre
  • continuez sur Gdoc je ferrais les interactions de l'ondine


Spoiler:
 


Revenir en haut Aller en bas
Mar 14 Nov - 13:27
avatar
√ Arrivée le : 22/01/2016
√ Messages : 893
√ Localisation : dans la galaxie Pégase


Dossier Top Secret
√ Age: 27 ans
√ Nationalité: États-Unis États-Unis
√ Gêne: Inoculation
Voir le profil de l'utilisateur
Aiden Ford



Bon ! Je commences à en avoir ma claque de la flotte, je prends le manche de la pagaie cassée pour sonder la profondeur : pas de fond ! Bon donc on est au moins 1m50, 2m au-dessus du fond ! Et puis je reconnais un des tas de branches reptiles comme à l’entrée ! Pas que ça d’ailleurs ! Y en a pleins ! Et sur des machines ont dirait. Et des serlianes ! Et un “yaya” ! D’ailleurs ! C’est désagréable cette forêt avec ces serlianes qui observent mine de rien. Notre amie fait pareil elle regarde comme si elle découvrait l’endroit ! L’air était rempli des mélopées cristallines des plantes-serpentines. Je connais pas l’air mais c’est apaisant ! J’eu l’impression que les serlianes se saluaient, pourquoi pas ? Soudain une boule vint se poser sur la serliane de Avalon ! Un Yaya ! Blanc, violet et rouge ! Très seyant ! Et que le volatile papouille la serliane qui le lui rend bien ! Et c’est alors que je remarque l’écran géant pleins de chiffres et d’infos imbitable que j’entends « Mymy ! Moi être Mymy ! Moi parler langue vous peu ! », enfin un interlocuteur qui cause la langue ! J’allais lui répondre un truc, du style “ Bonjour Mimy ! Moi c’est Ford, comment vas-tu ?” quand une voix d’homme s’éleva provenant des arbres, il causait je sais pas trop quelle langue, même si certains “charabias” me rappelait des choses entendues ailleurs ! Je cherche du regard où est le responsable quand l’arbre se retourne vers nous ! J’en ouvre la bouche d’étonnement ! Un “chose” mi-plantes, mi-poisson, et pas contente on dirait ! La serliane se tend vers le bidule et voilà que ça discute ! C’est peut-être parano mais je crois bien qu’on cause de nous ! Le voir si près des canots ça me fait un peu flipper !

” Bon ! Alors je confirmes les ordres précédents ! On garde les flingues bien cachés et on panique pas ! Mister Fish and green, là ! Il pourrait nous exploser nos bouées canards d’une claque ! Et ça sans parler de toutes ces braves serlianes “VE-NI-MEUSES” ! Espérons que notre copine soit un bon avocat !”

J’avais dis tout ça à voix basse, puis réalisant le double sens du dernier mot je fus pris d’un fou-rire (vous savez celui qu’il faut pas avoir mais qui vous vient sans raison !) La serliane de notre groupe s’était tendue vers le machin et s’enroulait autour du bras du gars /fille ! Et puis comme ça la chose nous balance qu’une certaine Emeryan nous a à la bonne ! Avalon et moi ! Nous demande ce qu’on fait là et nous reprochant de ne pas être restés dans la cité ! Avec un petit mot insultant sur l’espèce humaine !

Nastasha Avalon


Ils pénétrèrent dans la première salle et, dans la mesure où Ford ne cria pas à la fuite, Natasha en déduit qu’il n’y avait pas de danger immédiat. C’était un beau bordel d'enchevêtrement de câbles, machines, bois et serpents… c’était un peu la particularité des lieux d’un côté, il était difficile ici de faire la différence entre les plantes et les animaux. Les serlianes pullulaient mais aucune d’entre elle n’avait cette belle couleur vert émeraude que sa ceinture 2.0 semblait porter au naturel… peut-être était-elle une cousine éloignée, plus rare, de cette race de serpent-boisé ? Si elle ne se sentait pas menacée, Natasha n’était pas totalement rassurée par la présence de toutes ces créatures venimeuses. Elle espéra que sa nouvelle amie la protègerait si les choses devaient déraper, après tout cette dernière semblait converser avec les autres serlianes c’était donc qu’il y avait une réelle intelligence chez ces animaux. Tout à coup, quelque chose bondit sur leur canot et Natasha poussa un “wow” de surprise alors que un “bébé yaya” s’enroulait autour de sa ceinture 2.0. Décidément, elle devait ressemblait à un perchoir…
La serliane et le “yaya” se firent des câlins et Natasha ajouta cette observation au reste de sa longue liste : en plus d’humour, elle était douée d’affection. Elle tenta tant bien que mal d’orienter sa caméra pour les faire entrer tous les deux dans le champ, c’est alors que la petite chose se mit à leur parler en gros plan (les scientifiques allaient être contents) :

« Mymy ! Moi être Mymy ! Moi parler langue vous peu ! »

Il parlait leur langue ! C’est vrai, la botaniste leur avait dit que les représentants de cette race pouvait apprendre leur langue mais celui ci… où avait-il apprit ?

-Salut, répondit Natasha avec douceur, bientôt suivi par Ford.

Tout à coup, une voix résonna… et une nouvelle créature bien plus grosse se rapprocha. Une chimère partiellement humaine ? Wow, c’était nouveau ça. En tout cas, la voir converser avec la serliane et Mymy la rassura : si cette créature était intelligente et capable de communiquer avec sa protectrice elle n’allait pas les attaquer… si ? En tout cas, elle était assez importante pour que sa petite ceinture de huit mètres se détache d’elle afin de lui parler. Ford profita de l'aparté pour glisser des ordres. Sortir des armes ? Ca ne lui avait même pas traversé l’esprit. Par contre, l’expression de la chimère humanoïde ne lui plaisait pas beaucoup… elle avait l’air de ne pas apprécier leur présence ici. C’est alors qu’elle se mit à parler dans un anglais parfait, ce qui surprit Natasha. Elle s’était demandé où Mymy avait apprit ? Et bien il semblait que la réponse se trouvait devant elle, ce qui déportait la question sur l’autre créature chimérique. Elle leur expliqua que Ford et elle avaient attiré l’attention d’un certain Emeryan… Emeryan… c’était sa serliane ? Elle avait donc un nom ? Elle fut ravie de cette information : il y avait donc des moyens de communiquer avec sa nouvelle amie par de vrais mots, elles pouvaient se comprendre en passant par Mymy ou cet impressionnant triton aux allures dédaigneuses ! Par contre, la situation leur échappait totalement : la chimère humanoïde était trop bien informée, maitrisait trop bien leur langue… c’était un personnage clé dans cette histoire et il leur était hostile; ce n’était pas bon du tout. Ils n’eurent pas le loisir de répondre puisqu’Emeryan prit aussitôt la parole, chantant dans sa propre langue qui lui était incompréhensible. Elle semblait mécontente ce qui, en un sens était rassurant : en cas d’embrouille, elle prendrait peut-être leur parti pour les protéger.

Pedge Allen


En entrant dans la salle de droite, Ford décréta qu’il fallait changer à nouveau de canot. Pedge s’exécuta, mais elle commençait à en avoir marre que ça change à chaque fois. Enfin qu’importe, c’était certainement mieux ainsi, et elle espérait simplement qu’il ne mettait pas Bricks à la surveillance de la civile pour la punir ou qu’il ne la mettait pas dans le canoë de derrière parce qu’il la jugeait inapte à répondre à une menace devant. Mais ce n’était probablement pas ça. Maintenant qu’elle pratiquait le loustic, elle pensait plutôt qu’il avait besoin d’être sur le devant de la scène. Elle se demandait s’il était comme ça avant de se faire chopper par les Wraiths et de développer des capacités hors norme. Si oui, il devait quand même déchanter quand il était un humain normal de ne pas rivaliser avec tout le monde… Bref, elle se reconcentra sur la mission et sur l’entrée dans la salle. Le niveau de l’eau était toujours haut, et il était impossible pour le moment de descendre de l’embarcation sans couler. Est-ce qu’un kit de plongé aurait été utile ? Probablement, mais il y avait déjà tant à explorer et à voir en surface qu’il semblait superflu pour le moment d’aller voir ce qu’il se passait sous l’eau, sans parler que la présence des troncs alligators qui rendait la tâche périlleuse.

La végétation était partout, absolument partout. Elle laissait cependant la place aux lumières, rendant le lieu lumineux, contraste saisissant avec le couloir dans lequel des lampes avaient cassé avec le temps et la colonisation florale. Il y avait des dômes, probablement constitué de « serpent » comme ils avaient pu voir à l’entrée. Ici, du matériel ancien semblait coexister avec l’environnement forestier. De nombreuses lianes les accueillirent, papotant avec celle qui entourait toujours Natasha tandis que dans le fond de la salle, un écran fonctionnait, offrant à leur vue une ribambelle de données qui défilaient rapidement, sans aucun sens pour Pedge qui laissa tomber son observation pour se concentrer sur les alentours. La menace pouvait surgir de partout, malgré l’ange gardien présent dans le bateau numéro 1.

Un « yaya » fit son apparition. Pedge ne l’avait pas entendu arriver, vu qu’elle se trouvait dans le canot de devant, et ce fut quand il s’adressa à eux qu’elle se retourna pour l’observer ; Il était mignon, avec ses couleurs différentes, quoiqu’un peu flippant avec ses yeux vairons. Elle n’aimait pas ça. Ce n’était pas symétrique. Enfin qu’importe. La bestiole était en train d’essayer de communiquer et elle était compréhensible. C’était assez stupéfiant. Mais pas le temps de s’émerveiller devant cette petite peluche trop mignonne qu’une voix s’éleva dans les airs. Pedge fit volte-face rapidement, son arme non loin d’elle prête à servir. Elle pouvait lâcher la pagaie à tout moment et canarder au besoin. C’était quoi encore ? Ce qu’elle avait prit pour un arbre était en fait une espèce de sirène arbre, un truc bien chelou qui sortait tout droit de l’imagination d’un fantaisiste bien inspiré !

Ford demanda à ce que les armes restent cachées, et Pedge ne comptait pas le contredire pour le moment, ne connaissant pas les intentions de la nouvelle créature aux yeux jaune qui écopa d’un surnom de la part du Lieutenant. Elle ne savait pas si c’était très malin de se foutre de sa poire. D’ailleurs, il ponctua sa réplique par une blague qui le fit rire. Pedge ne la comprit pas tout de suite, parce que déjà elle ne voulait pas l’effort, et qui plus est, son humeur de chiottes ne la rendait pas du tout réceptive à l’humour. Il n’empêche que c’était le paradis pour les biologistes et les botanistes. Limite s’il ne fallait pas que ces deux professions s’accouplent pour pondre un petit scientifique tout mignon portant les deux casquettes afin de pouvoir répondre à toutes ces découvertes surprenantes. La serliane fit un pont entre les canots et l’ondine qui venait se mêler à la danse des verbiages incompréhensible. Il ne fallait pas être fin observateur pour voir que tout ce petit monde communiquait bien, dans un langage qui leur était propre. L’air dédaigneux de la sirène ne plaisait pas à Pedge. Elle s’adressa à eux dans un anglais impeccable. Décidément, c’était surprise partie.

Personne ne prit le parti de répondre à sa question, aussi Pedge le fit-elle naturellement même s’il fallait reconnaître qu’elle ne savait pas bien quoi dire à cette créature. « Les terriens sont curieux de nature. », répliqua-t-elle alors que la serliane occulta totalement sa réponse pour capter l’intérêt de la sirène sylvestre. On aurait clairement dit que l’animal allongé engueulait l’arbre. La texane se demandait si elle faisait de l’anthropomorphisme ou si la bestiole était vraiment transparente dans ses expressions. Maintenant, elle boudait. Elle en aurait mis sa main à couper. La sensation d’intelligence générale qui transpirait de tout ça ne laissait pas de doute quant au fait que ces animaux végétaux étaient dotés d’émotions en tout genre, se rapprochant de la gamme des humains, ce qui les rendait aisé à décrypter malgré la barrière de la langue. Il restait juste un point important à éclaircir… Le sujet de la dispute. Si c’était eux, ce n’était pas bon signe. Le « Yaya » se chargea de faire l’interprète pour éclairer leur lanterne.


Aiden Ford


La serliane et lui s’engueule de nouveau, cette fois c’est la copine qui a ouvert les hostilités ! Mymy nous traduit le conflit : Emeryan, la serliane sympa ! Reproche à son “maître” de pas lui avoir appris notre langue ! ”Oui ! C’est son nom ! Natasha ! Moi c’est Aiden Ford ! Et voici Pedge Allen et Nelly Bricks ! Enchanté Mymy !”, il est certain qu’en y prenant attention on distinguait les noms de notre groupe, avec un top number one pour Avalon ! ” Docteur vous allez pouvoir ouvrir un cabinet ici ! Elle vous adore la petite Emeryan !”, Mymy se mêla des échanges entre “Le Maître” et Emeryan ! Puis il se produit un drôle de patacaisse : des fils branchés à une machines, des électrodes placées sur la tête de notre copine. On dirait que la machine lui envoie des trucs, des infos ? Des ondes punitives ? De l'écran on voyait des lettres latines et des mots de vocabulaire anglais. Ah d’accord ! On lui apprenait l’anglais ! Bon ben on va causer comme au p’tit Kevin !

L’échange se termine avec un “t’es content !” du “Maître” ! Et Emeryan qui se radine et qui lance : « Tu me comprends ? », enfin plutôt un truc comme : ttttuuuuuuuuuuuu mmmmmmeee ccoommmmmppprrrennnds ???, puisqu’elle l’exprime de son chant cristallin et Mymy qui précise, parlant de Avalon, qu’effectivement, elle comprend ! Pourquoi c’est jamais moi, le pote des chouette animaux ? La serliane regarde Avalon comme si elle attendait une réponse; Moi je me tourne vers machin-truc-bidule-chose : ” Je vous demande bien pardon ! Mais dites-moi quel est votre nom ? Quel est donc cet endroit ? En seriez-vous le Roi ? Nous sommes venu en paix ! Admirer ces forêts de près ! Pourriez-vous nous éclairer de votre science ? Comme cette machine qui donne la Connaissance ?”

Mon discours était en rimes et sur une mélodie improvisée : rien de comparable à ce chant cristallin, mais qui dénotait un esprit de bon vouloir qui ne devrait pas passer inaperçu malgré le mépris de Sa Majesté Tree O’Fish ! Généralement les gens aiment bien quand vous faites l’effort de parler leur langue ! Et si cette machine nous apprenait à nous quatre de parler et comprendre le Lantien, putain la découverte !


Nastasha Avalon



Bienveillant, Mymy décida de faire la traduction pour permettre aux aventuriers de suivre l’échange entre la serliane et le triton. Emeryan était en train de lui reprocher de ne pas lui avoir appris l’anglais. Elle comprenait les regards agacé de la chimère humanoïde s’ils étaient la cause de la dispute, d’un autre côté elle était plutôt contente qu’un être aussi spécial que cette serliane ait envie de dialoguer avec elle. En tout cas, elle était maintenant sûre que le triton était plus important que la plupart des autres créatures rencontrées jusque là : c’était lui qui faisait office de professeur. Mymy posa une question à laquelle s’empressa de répondre Ford, Natasha se contenta donc d'acquiescer de la tête.

En tendant l’oreille, il était effectivement possible de capter quelques sons et leurs prénoms semblaient revenir régulièrement, notamment le sien. Ford le lui fit d’ailleurs remarquer.

-Le coin est un peu humide à mon goût, mais je verrai bien une table de massage là-bas, plaisanta t-elle tout en observant du coin de l’oeil le corps de la serliane qui était en train de noircir. Oula, ça se disputait sévère par là-bas !

Mymy s’en mêla et Natasha en profita pour étudier les relations entre ces trois protagonistes. S’il était évident que le triton était particulier, peut-être l’un des aînés ou bien le maître des lieux, les deux autres n’avaient pas peur de monter le ton et d’exprimer leurs avis. Elle hésita un instant à prendre sa radio pour contacter Frei avant de se raviser : l’équipe du major n’avait pas de canot pour les rejoindre et elle n’avait pas encore suffisamment d’informations tangibles à leur transmettre. Plus tard peut-être. Au moins, elle avait de jolies images capturées par sa caméra.

Soudain, le silence revint et quelque chose se passa : une machine s’activa, une aiguille se planta et Natasha fit une grimace. Le triton était il en train de punir Emeryan ? Non, elle ne se serait pas laissée faire… tout ceci devait avoir une signification. Il y avait des lettres bien connus qui défilait… un transfert de données ? C’était possible ça ? Ca avait l’air douloureux en tout cas.

La processus finit par s’arrêter et la serliane revint se lover tout autour de Natasha. Peinée, cette dernière lui fit un câlin. Si elle n’avait pas encore bien saisi les implications de ce à quoi elle venait d’assister, elle avait bien comprit que sa nouvelle amie avait souffert. Et puis tout à coup, la serliane s’adressa à elle dans un anglais chantant et difficile à saisir, mais un anglais tout de même ! Natasha en resta pantoise. Elle acquiesça de la tête avant de réaliser brusquement qu’elle pouvait lui parler et être comprise.

-Oui, souffla t-elle. Emeryan ? Demanda t-elle pour confirmer qu’il s’agissait bien de son nom.Tu as appris si vite… J’ai tellement de questions !

Mais Ford avait commencé l’interrogatoire avec la chimère humanoïde et Natasha tourna la tête pour écouter les réponses qui ne manqueraient pas de l'intéresser. La suite promettait d’être passionnante.

Pedge Allen


Emeryan n’était pas content. La Serliane, traduisit automatiquement Pedge dans sa caboche. C’était elle qui ne semblait pas apprécier de découvrir qu’elle ne causait pas l’anglais à contrario de l’arbre. Etait-ce le scientifique des lieux ? Une forme de professeur ? Etait-ce lui qui pilotait tout ça ? Qui gérait l’écran ? Probablement. Mymy demanda à Natasha si Avalon, c’était elle, et ce fut Ford qui répondit à sa place, en présentant toute l’équipe. L’américaine sentait qu’elle n’était pas directement le centre d’intérêt de la conversation même si patronyme pouvait revenir. De toute façon, le lien affectif et protecteur de la serliane, alias, Emeryan, était surtout visible vis-à-vis de Natasha. D’ailleurs, son nom revenait souvent dans les sifflements chantant du serpent à écorce. Finalement, la petite bestiole poilue se mêla à la conversation avec la sirène. Mi poisson, mi tronc.

Pedge cogitait de son côté. Ils étaient exclus en quelque sorte de la conversation par la barrière de la langue. Alors elle faisait un point, laissant le soin aux autres de suivre ce qui se passait dans le débat s’ils pipaient quelque chose. Manifestement, les cibles des lianes serpents étaient les lézards à pétales et pas les « yaya » que contenaient les plantes sur lesquelles étaient disposés les pétalézards, sinon la serliane aurait bouffé tout cru Mymy. Pourtant, ces deux là semblaient s’apprécier, et jouir d’une certaine complicité. Est-ce que ça ne devrait pas être le contraire ? C’est vrai quoi. Au final, les pétales formaient une forme de protection pour les petits « yaya » et pourtant, ils n’en voulaient pas aux prédateurs « naturels » de ces lézards qui venaient foutre la merde dans l’architecture florale des fleurs. C’était quand même risqué pour leur progéniture, non ? Un mystère de plus à découvrir. Il n’empêche, il semblait quand même y avoir une hiérarchie de l’intelligence dans les relations entre les animaux. Jusqu’ici, la serliane, les « yaya », et l’ondine végétale avaient manifesté des signes avancés d’intellect digne d’un humain (la comparaison de référence pour étalonner une mesure similaire à la leur). La serliane s’était clairement moquée des troncs en les faisant passer pour des crétins affamés, et ces derniers, à part faire preuve de cannibalisme et de gloutonnerie, n’avaient pas vraiment montré qu’ils communiquaient. C’était plutôt instinctif, comme un animal le ferait. Idem pour les pétales, qui ne semblaient pas réagir autrement que par instinct. A part détaler comme les bonnes proies qu’ils étaient, et opérer des défenses opportunes comme avec l’eau qu’ils avaient eu sur eux bien malgré eux, ils ne communiquaient pas.

L’attention de Pedge fut conquise par l’ondine qui planta une aiguille dans la tronche d’Emeryan. Venait-elle de la tuer ? Apparemment non. Elle ne semblait pas apprécier le traitement mais elle était vivante, et dans le dos de la sirène, les données sur les écrans s’affolèrent, rappelant des éléments de langage et de vocabulaire anglais. Elle n’était quand même pas en train de lui apprendre la langue, si ? Si c’était le cas, cela voulait dire qu’il y avait une part de robotique dans ces créatures, pour qu’elles puissent être mise à jour comme ça ! C’était impossible à faire avec un cerveau biologique… Mais si c’était le cas, cette découverte était la porte à toutes les possibilités d’apprentissages et c’était tout simplement scandaleux et impensable ! Le traitement fut court. L’arbre lui demanda si elle était contente, comme un vieux papi gâteux qui se fait trousser par son petit-fils trop mignon sans pouvoir dire non.

Emeryan revint vers Natasha et lui demanda, en anglais mais avec cette forme de chant cristallin qui le caractérisait depuis le début, si elle le comprenait. Mymy lui confirma que oui. Elle aurait rajouté « crétin » que ça n’aurait pas dénaturé le sens profond de sa réponse à la serliane. Tandis qu’Avalon répondait à la créature, Ford se lança dans une série de questions en chaîne. Pedge soupira. Il était usant, et l’arbre sirène avait intérêt à avoir le cœur accroché pour suivre. Qu’est-ce qu’il la saoulait à être démonstratif, elle qui était si morne et flegmatique. Il en faisait des tonnes, dans ses intonations, ses dires, toujours haut dans les tours. Un vrai énervé qui ne se canalisait pas, et ça commençait à lui taper sur le système. Elle jeta un coup d’œil à Nelly, et à Natasha, histoire de s’assurer que tout va bien, et elle se réajusta dans son canot, remarquant qu’elle serait la pagaie à s’en faire blanchir les phalanges. Elle modifia sa prise dessus et elle la rangea le long de sa cuisse dans le bâteau. Elle crevait de chaud avec cette combinaison NBC sur les jambes, et l’effort de la rame n’avait rien arrangé. Doucement et à geste lent, elle prit sa gourde pour boire, en attendant la réponse de l’arbre monde.

Nelly Bricks



Nelly avait progressé en respectant l’ordre de distance.
Elle n’était pas spécialement rassurée de savoir la serliane tout le temps dans son dos. Natasha lui faisait visiblement une entière confiance mais imaginez que la créature n’était pas si gentille que ça ? On sait pas, du genre à protéger la belle masseuse pour l’envoyer droit en pâture au mâle Alpha. Possible non ?

Enfin bon, elle s’arrangerait pour la protéger, elle était là pour ça après tout. La scène qui suivait la laissa pantoise et résolument neutre. Tout ce qu’elle voyait était tout aussi grisant qu’inquiétant. Ne pas voir de menaces partout, d’accord. Mais quand même, voilà qu’ils croisaient des espèces doués d’une intelligence qui dépassait le : “ MIAM LA PAGAIE !!!!”

Nelly préféra ne pas approcher le canot lorsque Natasha fût visée par les créatures inconnues. Respectant les deux mètres en question et ne touchant pas à son arme, elle gardait la pagaie dans la main dans le cas où il faudrait faire un demi tour de toute urgence. Bon, ce serait pas très efficace comme fuite mais elle n’avait rien d’autre à faire que d’assister à la scène et se tenir prête.

Par contre, le coup de l’aiguille l’angoissa soudainement. Lorsqu’elle remarqua que la créature allait se la prendre dans la tête, Nelly détourna brutalement le regard avec un sourire contrit. Sa main était machinalement venu frotter le creux de son coude alors qu’elle ignorait volontairement la plainte de mécontentement qui montait.

Finalement, cela se révélait être un bonne chose.
SuperFordy s’y mettait, peut-être un peu trop là, mais elle n’avait rien à dire. Alors la petite espagnole resta silencieuse et ne se permit qu’un large sourire dès qu’elle croisa le regard de Pedge. Qu’est ce que la suite allait leur réserver ? Ami ou ennemi ?

La faune/flore


Mymy regarda immédiatement Ford quand il répondit à la place de la jeune femme rousse…
« Elle pas savoir parler pour toi parle à sa place ? » Dit-elle en tourna la tête sur chaque personne qu’il présentait. Elle répéta les noms pour les enregistrer en murmurant : « Aiden Ford homme sombre, Pedge Allen, femme sans expression, Nelly Bricks petite humaine, Natasha Avalon copine Emeryan » Puis elle secoua son plumage d’un air ravie « Enchanté ! »

Puis il eut le transfert et ce maudit débats assez mouvementé.
Emeryan était concentré sur Natasha qui lui répondait. Il semblait satisfait, comme en témoignait les couleurs plus vive de son corps.
« Oui ! C’est mon nom ! Moi aussi j’ai pleins de questions ! » Répondit la serliane joyeusement de son chant cristallin… mais s’arrêta brusquement de chanter, quand Ford parla… Il se tourna vers lui tout comme Mymy qui fermait les yeux d’un air de dire “aie aie”.

L’ondine, était en train d’observer d’un œil à la fois intrigué et septique le début d’échange entre sa serliane et cette jeune femme… Une forme de jalousie, pouvait se voir dans son regard. Et quand Ford lui parla, il eut un air courroucé.
« Ma science n’est pas pour des humains aussi peu évolués. Et vous posez trop de questions sans intérêt. Contentez-vous d’observer toute cette beauté et repartez ! »
« Pourtant ils te ressemblent mais sans barbe et sans visage plissé » renchérit Emeryan « Ils sont de ton espèce ! Tu peux vivre à nouveau avec les tiens ! Depuis tout ce temps Elija ! Bon d’accords Ford a l’air bavard et parle vite et fort. Mais ils ne sont pas si dangereux… »
Vraiment ? Oublies-tu qu’ils ont tués l’un des tiens ? Qu’ils ont pris une plante avec ton enfant ? Avec Yaya ?! Ils l’ont tué aussi ! »
« Non, Yaya chante encore, ont la vue sur ton écran ! »
Et ton enfant ? Cette Serliane était bien de ton gène non ? Ils ne sont pas des membres de mon espèce, ce ne sont que des inférieurs ! »

Emeryan baissa la tête mornement. « Ce n’est pas eux qui ont tué Olivie… »
« Et sert à rien d’avoir responsable ! Eux ignorants ! » Dit Mymy d’un air sage. Elle s’était enroulée sur la bouée du canot.
L’ondine soupira dédaigneuse.
« Je n’ai plus de considérations humaines ! Qu’ils partent où ils disparaîtront ! »
« C’est moi qui dirige les gardiens… » soupira en chantant la serliane, alors qu’il eut un bruit cristallin plus fort et Emeryan hocha la tête. « Tu as peur ? Continue donc tes expériences si tu ne veux pas des tiens, ignore-les ! Vieux grincheux ! »
Mymy releva la tête vers la serliane « Non pas peur, lui jaloux Emeryan... »
La serliane semblait intriguée et secoua la tête incrédule comme pour dire “mais non”.
« Revenez… Ils ne méritent pas votre attention »
Emeryan l’ignora clairement. reportant son attention sur Natasha. La sirène semblait en colère… elle s’éloigna d’un air méprisant envers les humains tout en observant quand même.

Il y eut un bruit de radio que seul Ford put recevoir.


Aiden Ford


Quand je dis que les gens aiment bien qu’on fasse l’effort d’aller vers eux, c’est valable si l’autre veut échanger autre chose que des insultes ! Hors Mister Big lui c’est le genre qui vous aime pas et ne s’en cache pas ! On serait donc des abrutis et on devrait juste faire nos photos touristiques et se barrer. C’est Emeryan qui lui répond et là je manque de tomber du canot tant ce qu’elle balance est énorme ! Ce truc serait humain ? Non ? Pas possible ? Et pourtant elle le nomme Elija ! C’est très américain comme prénom ! Mais lui il rejette ce point nous accusant d’avoir tué une serliane, d’avoir enlevé “Yaya”, c’est sûr que dans son état de nerfs je vois mal lui expliquer les diverses erreurs commises par les grosses têtes de la cité ! Ni quelle aide précieuse fut la bébête. Mais attendez ! Comment ça on l’a vue ? La cité est surveillée par des plantes intelligentes et un grand poisson végétal colérique ? S’il a accès à tout, tu m’étonnes qu’il ait une si mauvaise opinion de nous !

J’ai pas de souvenirs qu’on ait déjà éliminé une serliane, Olivie ? C’est comme ça qu’Emeryan l’a appelée. Mymy et elle semblent nous penser innocents même si “l’homme sombre” est trop bavard et parle vite et fort ! Malgré tout Elija lance une menace : on part ou on disparaît ! Je crois que c’est clair ! On ne recevra pas de cartes de voeu de ce type pour la nouvelle année ! Emeryan le prit moyen et lui rappela sa position sociale, en l’envoyant à ses chères études, pour le coup, l’expression parlait vrai. Mymy précisa à sa camarade que Monsieur était jaloux, ce que la chef des “gardiens”, balaya d’un geste dédaigneux ! Elija implora le retour des deux végé-bestioles, puis partit bouder dans son coin sans nous quitter des yeux un instant. Un regard noir qui ne me disait rien de bon .

Et c’est à ce moment que la radio fit entendre son joli crachat, je m’assurais d’être resté en canal restreint et assez bas pour ne pas me faire remarquer mais suffisamment pour être entendu de mon interlocutrice, j’ouvris le canal pour écouter.

//"Lieutenant Ford, ici Frei vous me recevez ?"//
// Oui ! Major ! Je vous écoutes !//
// Est-ce que tout va bien de votre côté ?//

Super la question ! Va répondre discrètement avec tout ce monde autour !

//Euh ? Oui ! En quelque sorte ! Mais vous ne me croiriez pas si je vous disais ce que l'on a trouvé !//
// Je suis toute ouïe.//

Bien sûr ! Je vais te dire qu’on a trouvé un labo guedin avec pleins de serlianes un “Mymy” et un certain Elija qui yoyotte de la touffe ! Et tout ça sur le ton de la discussion entre gens bien nés !

//Pas maintenant je ne suis pas seul ! Si vous voyez ce que je veux dire ?//
//Je ne vois pas non, mais peu importe. J'aimerais que vous m'écoutiez sans trop poser de questions. Vous êtes en danger vous et votre équipe. Une entité malveillante hante encore les lieux et peut prendre la forme de n'importe quoi.//

Merci de l’annoncer maintenant ! Elija est peut-être malveillant, quoi que , mais je n’ai pas l’impression qu’il puisse changer de forme, il l’aurait déjà fait pour nous effrayer ! Elle ne doit pas parler de lui ! Bon je vais devoir poser des questions, soit clair ! Déjà qu’elle a pas captée que tu lui disait que le groupe était entouré d’hostiles potentiels !

//Genre ? Taille et qualités ?//
//Aucune idée, mais il agit seul et est menaçant. Vous devez vous méfier et le prendre comme une cible sérieuse. Compris ?//

Cool ! Les serlianes ça compte pour dire qu’Elija n’est pas ce tueur solitaire changeforme ? Il est menaçant ? Oui, un peu quand même ! Mais s’il était si dangereux, Emeryan nous aurait mise en garde, elle ou Mymy, d’ailleurs ! Et puis ils/elles sont trop désinvoltes, on est pas aussi méprisant devant un géant psychopathe. Sauf si c’est lui qui à tué Olivie pour je ne sais quelle raison .

//Seul ? Seul ? Où avec des alliées ?//, la réponse ne me redonne pas plus confiance :
//"Je ne sais pas s'il est vraiment seul mais d'après le docteur Femens c'est un Ancien et c'est lui qui a créé cet endroit. Soyez prudents. Frei terminé.//

Merci ! Je fermes ma gueule alors ! Ils arrivent ! Ils arrivent ! Ici ? Non sûrement pas ! Si Elija est juste un gros bougon, là un nouveau car de touristes il va pas aimer ! Et ils viennent comment ? En volant ? Les deux canots sont là ! Ils comptent battre le record de Pégase de la nage en bassin fermé infesté de monstres voraces ? On va devoir se tirer d’ici discrètos ! Ou pas , faut voir, Elija sera content de nous voir partir.

//Reçu Major ! Ford terminé !//

Je me tourne vers Allen et lui dit à l’oreille : ” Le groupe du Major vient par ici ! Une menace indéterminée errerait dans les environs ! On se tient prêt en cas de menaces inconnues, je ne penses pas qu’il soit question de nos amis ni d’Elija ! Mais d’autres humains pourraient le mettre en rogne et là on aurait un drame ! On fait demi-tour ! Bricks et Avalon devant et nous en soutien derrière : Les jaloux c’est imprévisibles !”

Allen va sûrement encore me détester pour ça ! C’est pas croyable comme elle est rigide comme fille ! Enfin ! C’est pour ça que c’est un bon soldat ! Je commences à ramasser la seule pagaie du canot, et commences doucement à faire opérer un demi-tour au canot pendant que Allen fait savoir par signes à Bricks qu’elle doit en faire autant et sortir dans le couloir. Je sais pas pourquoi mais je le sens pas le scénario de ce film ! Pour une fois si ça pouvait juste être de la parano !

Une petite boule de plume se posa délicatement sur l’épaule du valeureux soldat. Mymy dans son empathie exacerbée : « Toi faire quoi Aiden Ford l’homme ébène ? » Elle lui parlait joyeusement en lui toucha la joue de sa petite aile rouge. « Toi à l’air perturbé... »

Mymy est plutôt gentil de s’inquiéter de mon état, j’approche ma tête de la sienne et lui dit tout bas ” J’essaie d’éviter une erreur ! Mes amies craignent un danger et je dois les aider, mais pas ici, sinon Elija pourrait mal prendre cette invasion et eux pourraient mal réagir dans leur ignorance ! Et je veux pas de morts inutiles ! Le danger est ailleurs j’en suis sûr ! Mais tu gardes ça pour toi ! OK ?”
« C’est qui “eux” ? Tu as peur d’Elija ? » Elle parla doucement. En parlant de lui, la sirène avait disparu depuis longtemps. Depuis que Ford avait parler avec la radio.

Pas le moment qu’Elija nous fasse sa crise ! Si le changeur de peau traîne dans les couloirs ou dans les autres salles du complexe, ça sera bien suffisant comme ennemi ! Il est où d’ailleurs le “comme nous qui ne veut plus l’être” ? Je réponds à Mymy tout en regardant un peu partout sur et dans l’eau ou même aux murs ! Et c’est pas facile en manoeuvrant un canot avec une seule pagaie et vêtu d’un combinaison NBC. ” Peur ? Oui ! De ses réactions : on est des intrus et on menace son mode de vie, eux ce sont les autres humains avec nous ! Mais ils ont appris qu’un méchant errait dans les couloirs, et j’ai peur qu’ils prennent Elija pour lui ! Surtout si c’est pas lui ! Elija est toujours de cet aspect ? Il ne change pas de forme ?” Oui, je commences à paniquer, l'adrénaline arrive et mon corps est près à faire face au danger, mais je préfèrerais que ce soit pas ici !.

« Mais il est pas méchant, il est gentil, il donne la vie … » Elle s'interrompit soudainement en regardant l’eau étrangement.... « Arrête de bouger ton “chose”... »
Je m'exécute aussitôt !
Mymy semble écouter la faune…


Nastasha Avalon


Natasha avait observé le manège du chef de groupe en fronçant les sourcils, de plus en plus inquiète au fil des minutes. D’abord un dialogue plein de mystère avec la radio, puis des murmures mystérieux à Allen, il attrapait ensuite sa pagaie et se mettait à chuchoter avec Mymy… ça commençait à faire beaucoup et elle n’aimait pas ne pas comprendre ce qu’il se passait.

- Ford, qu’est-ce qui se passe ?

Elle baissa les yeux vers Mymy qui semblait écouter quelque chose dans l’eau… ok, elle commençait vraiment à avoir peur là. Tout à l’heure, Elija les avait accusé d’avoir tué le descendant d’Emeryan et ce dernier les avait défendu… Natasha s’était sentie coupable: même si elle n’y était pour rien, elle connaissait les atlantes responsables. Allaient-ils être punis pour la faute des précédents aventuriers ? En tout cas, Emeryan avait révélé une information capitale : il était le chef des “gardiens”. Elle ignorait qui étaient ces gardiens, mais elle savait maintenant que sa ceinture 2.0 était quelqu’un d’important ici et ça, c’était rassurant. Si quelque chose sortait de l’eau, il les protégerait… du moins elle l’espérait.

Nelly, juste devant elle, s’était tenue silencieuse. Elle était inquiète d’être au contact de forme de vie aussi intelligente, il était difficile de savoir ce qu’elles pensaient réellement. D’ailleurs, elle nota aussi qui tenait les “gardiens” et l’évident conflit qui se déroulait sous leur yeux.
Après, le coup du chuchotement pour Pedge, c’était quasiment un appel à la paranoïa là. Nelly sentait que quelque chose pouvait mal tourner. Ou alors elle se faisait des idées. Mais tandis que sa main droite se posait gentiment sur son arme, au cas où, elle se retourna vers Natasha pour lui sourire et lui rappeler, l’air de rien :

« Hé. Tu te souviens de ce que je t’ai dis juste avant d’entrer, hein ? »
- Euh… je me plie en quatre pour me cacher dans ta poche ?
« Masseuse et contorsionniste experte, c’est ça ! »
- Ok pour le massage mais le reste...

Nelly remarqua qu’il y avait une sorte de liane qui bougeait au dessus de l’eau… mais en réalité c’est la sorte de “cordon” qui reliait l’ondine au plafond… Celui-ci était derrière les canots vers l’entrée de la salle.

Pedge Allen


« Enchanté aussi », fit Pedge dans sa barbe à l’adresse de Mymy. Elle ne savait pas trop où se mettre avant que la créature aquatique mais pas que ne plante une pique dans la tête de la serliane, pique qui servira, comme ils allaient le constater, d’interface avec l’ordinateur pour transférer la langue anglaise. Quand Ford choisit d’assaillir de questions l’arbre, il se prit une réponse acerbe et sans appel. L’autre l’envoya carrément chier. On aurait dit une sorte de McKay ou de Radek, lesquels pouvaient vous regarder avec un regard vous faisant sentir plus con que le dernier des cons. Comme l’ignorance congénitale dont on faisait preuve était le pire des défauts dans ce monde et que leur génie respectif ne servait pas à faire comprendre à des imbéciles. Bref, le scientifique dans toute sa splendeur. Et après on venait chier sur les bottes des militaires quand ces derniers étaient revêches avec les civils un peu trop pédants.

Ce fut la Serliane qui répondit à Elija. Nom assez terrien pour le coup, laquelle appris au groupe que cette vieille souche à la langue aiguisée était comme eux, un humain. Pedge était perplexe… Qu’est-ce qu’ils avaient devant eux ? Après tout, les animaux plantes ici étaient certainement le fruit d’expérimentation, alors pourquoi pas un humain ? Ou des humains ? Des anciens ? Peut-être, peut-être pas… Il fallait des réponses, et c’était pourquoi ils étaient là. Du coup, la réponse « regarde et casse toi pov’ con » de l’autre enfeuillé marin n’était pas satisfaisante. Apparemment, il leur tenait rigueur d’avoir tué une Serliane et d’avoir kidnappé Yaya… Vraiment là ? Emeryan les défendit, et heureusement qu’il ou elle était là pour prendre leur défense, parce que l’autre avait sérieusement une dent contre eux. Le fait que la liane serpent mentionne qu’ils avaient vu sur les écrans Yaya chanter était assez flippant… Ils surveillaient toute la cité alors ? D’un côté, peut-être qu’ils connaissaient des ailes encore inexplorées des nouveaux colons atlantes. Quoiqu’il en soit, Olivie, puisque c’était le nom de la Serliane qui était devenue raide après avoir mordu Sheppard, n’était pas morte directement de leur fait. Bon, peut-être qu’en l’ayant soustrait à cet environnement, elle était morte de faim, car il semblait que ces lianes mangeaient des pétalézards, donc qu’elles devaient manger pour vivre. Ou bien était-ce une réaction au sang de Sheppard. Il ne serait pas fou de considérer que si les anciens étaient derrière ce genre d’initiative champêtre, qu’ils aient mis des gardes fous chez leur création afin de ne pas se faire baiser la gueule plus tard. Un peu comme dans Terminator avec les machines qui prenaient le pouvoir quoi… Donc, peut-être que si une des ses créatures s’en prenait à un ancien, elle crevait. John avait le gène, c’était indirectement un ancien de par son patrimoine génétique…

Pedge était en pleine réflexion. Finalement, Elija envoya chier, et les humains, et Mymy et Emeryan. Monsieur préférait bouder dans son coin à continuer ce qu’il faisait. Il faisait quoi d’ailleurs ? Pedge voulait bien essayer de savoir pourquoi il était jaloux, mais Ford ignora tout le monde pour se concentrer sur son oreillette. Il avait un appel radio ? Elle ne comprenait pas tout ce qu’il racontait, mais il ne semblait pas très rassuré dans ses réponses. Est-ce qu’ils étaient en danger ? Voilà qu’il se penche vers elle pour lui donner des indications.

« Bien lieutenant », fit Pedge sombrement. Si menace il y avait, il fallait se barrer avec prudence. Elle se tourna vers Brick pour lui faire signe qu’on rebroussait chemin tandis que l’amérindien était déjà à la manœuvre pour faire pivoter le canot. Tant pis pour les réponses à leurs questions. D’un côté, Emeryan et Mymy restaient avec eux, et ce fut d’ailleurs cette dernière qui vint poser des questions à Ford. Avec un peu de chance, ces deux là leur permettrait de délier toute cette intrigue en répondant à quelques questions. Selon Frei, une menace roderait, et il ne pensait pas que ce fut Elija. Pedge non plus. Il était aigri certes, ronchon à souhait, mais s’il avait souhaité se montrer menaçant, il aurait fait en sorte qu’ils ne parviennent jamais jusqu’à lui, surtout qu’il devait savoir que cette expédition se montait par le biais de ses écrans…. Et si c’était bel et bien le cas et qu’il avait utilisé les moyens pour qu’ils n’arrivent pas ? Après tout, quand ils étaient arrivés par le téléporteur, la porte était coincée. Ensuite, la racine avait essayé de s’en prendre à Hamilton, et sur l’eau, ils avaient subi l’attaque des aligatroncs qui voulaient les mettre à la baille pour les becter. Etait-ce de son fait, ou était-ce simplement des réactions instinctives et animales ?

Quelque chose d’autre chiffonnait Pedge depuis la conversation entre Elija et Emeryan et aussi avec l’apparition de Mymy. Apparemment, Serliane et « Yaya » cohabitaient ensemble et semblaient bien s’entendre. Alors pourquoi est-ce que les lianes avaient essayé de les bouffer ? Elles visaient les pétalézards c’est vrai, et pas spécialement les « Yayas » dans la plante, mais les bestioles à pétales ne protégeaient pas les « yayas » ? Encore une question sans réponse, mais comme ils filaient à l’anglaise avec Emeryan, elle pourrait toujours lui demander par la suite. En plus, c’était le patron des « gardiens ».

Pedge prit le parti de répondre à la place de Ford à Natasha, occupé à discuter avec Mymy.
« On s’en va. L’endroit n’est pas… » Elle se la boucla elle aussi quand Mymy demanda à Ford d’arrêter de faire bouger le canot. Elle remonta sa pagaie à l’intérieur, en essayant de scruter l’eau… Ca sentait pas bon tout ça.

_________________
Aiden Ford Theme:
 





Médailles:
 


DC : Herakles Coeur de Thaïr
Revenir en haut Aller en bas
Mar 14 Nov - 13:48
avatar
√ Arrivée le : 01/08/2015
√ Messages : 379
Voir le profil de l'utilisateur
Equipe 2 Naviguez en paix
Chronologie 18 octobre 2017




La faune/flore


Mymy observait l’eau d’un air étrange… Puis regarda Emeryan du même air.
« « Toi sentir encore famille vers ancien laboratoire ? »
La serliane se détacha de Natasha pour onduler vers Mymy et toiser l’eau, où des sortes de masse semblaient se mouvoir.

« Non… » répondit la serliane dubitatif. Elle se dressa et se mit à chanter dans un air particulier… mais ne reçut aucune réponse. Emeryan, chanta en direction du plafond et les serlianes, lui répondirent. La serliane recommençait deux fois, comme dans un espoir…

Et soudainement, les canots se mirent à tanguer de plus en plus… des lierres étaient en train de compresser les canots pour les percer de leurs petites pattes blanches et de leurs crocs. Mymy se mit immédiatement à hurler en ancien, pour les chasser, mais cela ne marcha nullement… la petite boule de plume, sauta sur Emeryan.

« « Ils ne m’obéissent pas !!! Amis mourir ! » L’Orimi était en train de paniquer.
Alors, que déjà, il y eut un “psssccchtttt” signe que le canot de Ford, venait d’être percé et que des lierres s’enroulaient dessus, pour le faire couler. Très vite, cela commençait à devenir critique, puisque les canots étaient attaqués et des lierres essayait d’attraper les chevilles des humains. Il y en avait de plus en plus et non loin des troncs flottait en direction de la salle.

Informations :
L’un d’entre vous vois Elija, contre le mur à droite et qu’il observe. Il est bien camouflé dans la végétation.



Revenir en haut Aller en bas
Jeu 16 Nov - 19:54
avatar
√ Arrivée le : 22/01/2016
√ Messages : 893
√ Localisation : dans la galaxie Pégase


Dossier Top Secret
√ Age: 27 ans
√ Nationalité: États-Unis États-Unis
√ Gêne: Inoculation
Voir le profil de l'utilisateur
Nastasha Avalon



Natasha aurait aimé avoir tout le temps voulu pour discuter avec Emeryan et lui poser les nombreuses questions qui lui taraudaient l’esprit mais tout allait de travers sans qu’elle comprenne pourquoi. Ford et Allen avaient certainement plus d’informations mais d’ici à ce qu’ils les partagent et bien…
Quelque chose avait déclenché le courroux de certaines créatures. S’agissait-il d’Elijah qui, à bout de patience, avait décidé de les exterminer sans même leur laisser le temps de partir après sa première sommation ou bien de la volonté propre de ces animaux ? A en croire Mymy et Emeryan, quelque chose contrôlait ces espèces de lierre puisqu’eux même n’arrivaient plus à s’en faire obéir. Ces saloperies étaient en train d’envahir les canots et de les trouer, ils allaient finir à l’eau et à leur merci !


- Emeryan, ça nous rendrait bien service si tes amies Serlianes pouvaient nous porter comme tu l’as fait avec moi tout à l’heure !! S’écria-t-elle en essayant de ne pas paniquer.


Nelly Bricks



Nelly s’était exécuté dès que Pedge lui avait fait signe de faire demi-tour.
Elle commençait déjà à pagayer lorsqu’elle fut surprise par la présence du boudeur dans son coin là-bas. Il était tellement bien planqué qu’on l’aurait pris pour un voyeur. Instinctivement, la petite espagnole se méfia en se demandant à quoi ça pouvait lui servir de leur tourner le dos, de les virer de cette manière, si c’était pour les regarder partir ensuite sous une planque.

Ce n’est qu’au moment où ces multitudes de ronces montèrent sur les canots en tentant de les percer que Nelly parti du principe qu’il cherchait à les tuer ?
Qui ça pourrait être d’autre ? Si cela venait d’une source extérieure, cette chose ne se planquerait pas comme un gamin malfaisant qui regardait l’effet de sa connerie. Malgré le chaos du mouvement de son canot, Nelly plaça une main dans son dos en cherchant un contact avec Natasha tandis que, de l’autre, elle montait son arme en direction d’Elija. Elle aurait vraiment peu de chance de le toucher mais rien que la direction de son canon informerait le reste de l’équipe de l’endroit qu’elle pointait.

« Lieutenant ! “Géant vert” se rince l’oeil par le trou de la serrure !!! Flanc droit, direction de mon arme ! »

D’ailleurs, ne pourraient-ils pas essayer de couper la liane qui reliait Monsieur Pervers au plafond ? Si ça se trouve, il commandait les ronces à partir de ce truc...

« Je vous vois ! ARRÊTEZ ÇA TOUT DE SUITE !!! » Menaça-t-elle en le pointant difficilement de son arme.


Aiden Ford



Mymy semblait nerveux ou nerveuse, je sais pas si c’est un garçon ou une fille. Pour moi je me sentais comme dans un reboot malsain des dents de la mer. Le volatile interrogea Emeryan sur des problèmes avec sa famille dans l’ancien labo. Et là, les événements prirent un tour désagréable : Emeryan se détacha de Miss Avalon en répondant par la négative avec une inspection inquiète de l’eau où je commençais à distinguer des formes indistinctes ! Puis des fils de lierres assez agressifs commencèrent à prendre les canots à l’assaut, Bricks signala qu’Elija jouait les espions de mauvaise augure et Emeryan paniquée tenta un appel vers ses camarades alors que Mymy s’écriait que les plantes qui nous attaquaient semblaient insensibles à ses ordres ! Là ! Déjà j’étais dans le rouge point de vue sentiment d’agressivité et d’instinct de tueur mais quand j’entendis un PPssshhhhh !!! Puis un autre autour du canot j’étais en alerte defcon 99 ! Les petites saloperies tentaient en plus de s’enrouler autour de nos chevilles, pour nous entraîner dans l’eau je suppose ! Et là-bas devant l’entrée, des alligatroncs qui venaient pour la curée !

” Les barres chocolatées ! Jetez-en des morceaux dans l’eau loin des canots ! Les alligatroncs se battront pour en avoir et ça les retiendra un moment ! “

Je pris ma machette et frappais sur les lierres qui s’entouraient autour de mes chevilles ! J’ouvris mon sac et en sortit les rations pour en extraire les barres chocolatées et les briser en morceaux que je jetais au loin ! Bon ! De deux choses l’une ! Soit c’est un coup de salaud d’Elija soit il se cache du vrai responsable ! Dans tous les cas ça va pas se passer comme ça !

” Allen ! Position de tir ! Visez le cordon d’Elija ! Attendez mon go, pour tirer ! Bricks ! Protégez Avalon tant que vous pouvez mais surtout essayez de fuir d’ici ! Vous devez survivre pour témoigner ! “

Je pris une grenade incendiaire dans la main et je regardais vers Elija qui maintenant ne m’était plus invisible grâce à Bricks !

” Elija ! Vous n’avez pas à faire ça ! On ne vous veut pas de mal ! Si vous avez appelé ces choses ! Alors rappelez-les, je vous en prie ! Vous nous avez dit que vous étiez meilleur que nous ! Meilleur que l’humain que vous n’êtes plus ! Je ne peux imaginer ce que vous avez vécu pour en être arrivé là ! Mais on peut être vos amis ! Personne n’est obligé de mourir ! Ne m’obligez pas à commettre l’irréparable ! “

Je regardais Mymy et lui chuchotais : ” Eloignes tous les gardiens et tes congénères s’il y en a ici ! Qu’ils aillent loin d’Elija, passez derrière nous ! Si Elija ne s’arrête pas il va y avoir un grand mal ! Et je préfèrerais que seul Elija soit touché !”

Voilà ! Le drame était acté ! Allen tirerait dans le cordon d’Elija si le napalm ne suffisait pas et moi si Elija continuait à rester dans l’ombre à nous voir mourir alors je ne mourrais pas seul ! Et Frei qui disait arriver avec les civils ! Il ne fallait pas ! Tant pis pour nous ! Nos corps seront récupérés par une autre mission 100% militaire cette fois et dans une optique plus guerrière !

// Message urgent ! Ford appel Major Frei ! Restez dans le couloir ! N’approchez pas de la salle ! Si Bricks et Avalon parviennent à s’échapper, récupérez-les et rentrez dans la cité ! Mission d’extraction nécessaire ! Civils non recommandés ! Allons essayer de tenir aussi longtemps que possible ! Ennemis trop nombreux et dangereux ! Prévoir lance-flammes ! Je répètes ! N’approchez pas de la salle de droite ! Ford terminé !//

// Bien reçu Lieutenant. Tenez bon, on va vous sortir de là. //

Voilà j’avais fait mon devoir ! Restait une dernière chose à faire !

” Allen ! Vous êtes autorisée à regagner l’autre canot tant qu’il est encore possible de le faire ! Je retiendrais les hostiles ! Je ne veux pas vous conduire à la mort parce que je compte faire face à l’ennemi pour permettre à Avalon et Bricks de fuir. Vous ne serez pas déshonorée, ce n’est pas un acte de lâcheté ni d’insubordination ! Il faut un officier pour dire ce qu’on a vu ! Et on doit faire en sorte que les civils s’en sortent sains et saufs ! Je suis sans doute un piètre officier mais je suis fier d’avoir servi aux côtés d’un soldat tel que vous !”

Ouais un peu mélodramatique mais bon ! Au moins j’aurais la conscience tranquille ! Si on doit mourir ce sera en luttant férocement pour notre survie et les plantes qui survivront seront en piteux état ! Tiens ! Prends ça ! Saloperie de teigne à petites dents !

Pedge Allen


Et soudainement, des lierres sortirent de l’eau pour s’en prendre au canot. Instinctivement, Pedge commença à les bourrer à coups de pagaie pour qu’ils ne percent pas le rafiot, mais ils étaient nombreux, et quand elle en frappait un avec son instrument de fortune, il cherchait à s’enrouler autour, quand ce n’était pas un autre qui s’en prenait à elle par derrière, en cherchant à l’attraper par les chevilles, certainement pour l’attirer dans l’eau. Du coin de l’œil, elle vit les troncs qui se radinaient, dans l’espoir très certains de bouffer de l’humain, ou de ramasser les miettes. L’idée de Ford de balancer des barres chocolatées pour les éloigner n’étaient pas bête du tout. L’équipe avait vu à quel point ces troncs flottants aimaient ça ! Elle extirpa son couteau de sa ceinture et elle découpa du lierre pour se dégager afin de pouvoir lancer des morceaux de barres. Cela dit, ce n’était pas super aisé de couper les plantes, même avec le couteau effilé de combat. Il ne fallait pas non plus déchirer le fond du canot, sous peine d’accélérer la descente aux enfers vers l’eau. Déjà, l’air qui fuité d’un boudin n’était pas bon signe, et il allait bientôt falloir regagner la terre ferme sous peine de finir à la nage. Ils n’étaient pas dans la merde tiens.

La jeune femme balança donc des barres chocolatées dans la flotte, le plus loin possible du bateau et dans une direction opposée à Ford afin d’attirer le plus loin possible les créatures. Puis le lieutenant lui demande de se mettre en position de tir sur Elija, que Nelly était en train d’indiquer.

« Reçu ! », fit Pedge en empoignant son Colt M4 pour le pointer vers l’ondine. Elle n’était pas certaine d’arriver à toucher le cordon d’un seul tir, mais elle avait un chargeur de trente coups, cela suffirait surement. En tout cas, il n’allait pas falloir trop tarder à se décider parce que les lierres n’étaient pas partis se dorer la pilule au soleil eux. Ford tenta de négocier avec l’arbre après qu’il eut dit à Nelly de se tirer avec Avalon et d’avoir communiqué avec Frei. La dernière proposition de l’amérindien ne l’étonna même pas. Constamment sur Renégat il avait dit qu’il mettrait sa vie en jeu pour eux, et ce n’était pas différent ici. Elle souffla sur cette fameuse mèche de cheveux rebelle qu’elle n’arrivait pas à domestiquer, afin de la dégager de son champ de vision, et répondit de son ton morne habituel :

« Sauf votre respect lieutenant, je vais attendre avec vous que Flipper le dauphin vienne nous récupérer pour nous ramener sur la Terre une fois qu’on aura coulé en dézinguant toute cette mauvaise herbe. ».

S’il croyait qu’elle allait se barrer en quittant le navire, il se mettait le doigt dans l’œil. De toute façon, il y avait de fortes chances que le radeau de Nelly et Natasha soit aussi assailli par les lierres, donc ce n’était pas dit qu’elles arrivent à se sauver. Les deux jeunes femmes allaient devoir se débrouiller avec ça parce que Pedge, ou Ford, ne pouvaient pas faire grand-chose pour leur porter assistance. Tirer dans les ronces étaient impossibles sans percer leur canot. Bref, il allait falloir agir maintenant !

_________________
Aiden Ford Theme:
 





Médailles:
 


DC : Herakles Coeur de Thaïr
Revenir en haut Aller en bas
Jeu 16 Nov - 19:59
avatar
√ Arrivée le : 09/11/2014
√ Messages : 1343
√ Localisation : Atlantis


Dossier Top Secret
√ Age: 33 ans
√ Nationalité: États-Unis États-Unis
√ Gêne: Non
Voir le profil de l'utilisateur
La faune/flore


Il était incontestable qu’Emeryan ne comprenait pas ce qu’il passait et sa couleur de plus en plus sombre, indiquait qu’il était soit en colère soit qu’il avait peur. Il n’avait aucune réponse, sauf celles des serlianes ici et encore les chants semblaient étranges. La créature s’agitait sur les canots et se mit à bondir au plafond, après avoir jeté un regard à Natasha.
Mymy semblait scander des ordres en lantiens, mais rien n’y fait… il était trop tard. La boule de plume, semblait agité et était partie encore sur l’épaule de Ford, quand celui-ci lui donna un ordre qui la laissa pantoise.

« Moi contrôlé personne… Tout est vivant ici !
Les lierres aussi tenaces que les bons parasites qu’ils sont, emportèrent le canot, ne laissant nullement le choix aux deux occupants de sauter dans le dernier encore gonflé à bloc. Tout allait très vite, peut-être même un peu trop.

Les barres chocolatées eurent un petit effet, pendant quelques secondes les croco-troncs firent demi-tour pour les manger… mais quelque chose semblait les contrôler et ils fondirent sur les seconds canots, pour le mordre à nouveau ! Au plafond, il y avait des bruits cristallins assez fort.

Toujours en train d’observer Elija, remarqua qu’on venait de le surprendre. Il ne réagissait pas, en voyant Nelly s’égosiller. Il se déplaça juste, derrière les machines pour éviter qu’on lui tire dessus avec l’objet qu’elle pointait. Son câble, était visible, mais parfois difficile à identifier entre la végétation. Au vu des ordres de l’homme sombre, Elija, se mit d’autant plus en protection, pour camoufler son câble. Il comprend l’anglais. Et quand le même homme lui demandait de s’apaiser, il eut un petit rire.

« Et tirer sur mon câble, c’est pour me faire des gentillesses peut-être ? Je n’y peux-rien, si vous semblez appétissants … La nature chasse et doit se nourrir personne ne peut contrôler les instincts de prédations » Dit-il. Difficile de savoir s’il ment ou non. Mais dans tous les cas, les créatures préfèrent l’autre canot et les lierres de plus en plus nombreuses, serrait si fort l’embarcation, qu’elle se réduisait sous leur compression. Ils allaient tous finirent à l’eau.

Un dernier remous et une secousse qui envoya en l’air les humains… une chute qui allaient se finir dans l’étendu émeraude… Et finalement… et finalement non. À quelques centimètres de l’onde, les corps des humains, furent enlacés et ramenés au plafond par les serlianes.
Les lierres se dressèrent au-dessus de l’eau, montrant leur tête de canin ou de félin avec une longue mâchoire. Celle-ci étaient en train de claquer des dents férocement. Mymy toujours enroulé au cou de Ford, se mit à parler ancien et l’une des lierres lui répondit… Signe que les créatures féroces étaient aussi intelligentes. Le rugissement qu’elle lança à Mymy, effraya la petite créature, qui alla se réfugier dans les anneaux de l’alpha. Puis volta sur le premier humain proche d’elle : le ventre de Nelly, qui était maintenu en forme de siège.

« Fuir fuir ! ils ont faim !! » Tremblait Mymy.
Et sans plus attendre, les lierres, se mirent à nager vers les murs, pour grimper dessus. Des serliane étaient en train de fondre sur eux, gueule ouverte pour les mordre de leur venins… Très vite cela devint un combat épique ! Des lierres qui tremble et devienne noir, des serlianes découpé en deux par des mâchoires… cela était très vite un beau bordel monstre.

En réponses, les serlianes, qui tenaient les aventuriers fermement enroulées sur leur corps, commencèrent à évoluer pour revenir vers le couloir, le plus vite possible. Quittant la salle définitivement. Les humains étaient enlacés et semblaient voler doucement dans leurs passerelles de serliane, allant dans le couloir, pour rejoindre le bassin.

Mais ils n’étaient pas tous là !! Pedge fut dans les anneaux sombre d’Emeryan. Il la maintenait fermement à l’abris, pendant que les serlianes les protégeaient de l’attaque des lierres. Au-dessus des canots et allant vers les machines, tout en restant au plafond !

La tête triangulaire d’Emeryan se figea sur Pedge. « Je vais t’emmener au plus proche du cordon de vie. Soit rapide, les gardiens ne pourront pas repousser longtemps, la férocité des Lierres… » Il avait dit ça doucement et avec un air sombre presque accablé. Il savait ce qu’il allait se passer. Et cela le rendait profondément triste.

Aiden Ford


Maudit imbécile arrogant et dérangé ! Elija ne répondit que par la moquerie et l’incompréhension. Il ne comprenait pas que mes ordres n’étaient que pure défense face à son attaque et il se mit à se cacher en nous laissant nous débattre contre ses créatures.

” Fou que vous êtes ! C’est vous l’agresseur ! Nous devons bien nous défendre ! “ Le canot fut bien vite inutilisable et nous fumes contraints à nous rapprocher de l’autre canot et d’y prendre place. Nous luttâmes un bon moment contre l’invasion des lierres soutenue par les alligatroncs qui eux-aussi s’en prirent au canot qui rendit bientôt l’âme ! C’était fini nous allions coulés dans l’eau ! Je me préparais à affronter des ennemis en position de force dans leur milieu naturel mais il ne se passa rien ! Ou plutôt il se passa que soudain nous n’étions plus dans ou sur l’eau mais en l’air ! Les gardiens ! Ils nous portaient au-dessus de l’eau et c’est ainsi que nous pûmes voir les serlianes et les lierres se faire face et échangés des mots .

Mymy affolé nous appris que les plantes étaient affamés et ne voulaient pas obéirent et qu’elles semblaient sous contrôle cela confirmait le fait que la diversion friandises avait durée peu de temps avant que les troncs reviennent vers nous ! Nos soutiens nous entrainèrent vers l’entrée de la salle mais les lierres ne s’avouèrent pas vaincus et s’amassèrent contre le mur pour essayer de nous bouffer ! Alors ce fut la guerre des plantes ! Les gardiens tous assombrit se jetèrent à l’assaut des plantes grimpantes et ce fut un combat à mort des deux côtés. J’avais mal de voir ses frêles créatures mourir pour sauver la peau des fouteurs de merde que nous étions finalement encore !

L’enfer est pavé de bonnes intentions dit-on et bien le SGC avait contribué à en placer des kilomètres ! Emeryan emporta Allen pour une destination inconnue et nous alors ?

” Emeryan ? Et nous ? On peut aider aussi ! “

Avant d’être emmené dans le couloir, je me tournais vers Bricks et Avalon, elles aussi étaient bien saucissonnées par les serlianes en me tortillant un peu je parvins à sortir un bras de l’anneau de la plantes vivante, je m’empare de ma machette et par gestes et en tirant sur le corps de “mon” gardien, je m’approche du mur où luttent nos amies. Essayant de me balancer pour l’atteindre . Et là en passant, je commences à couper les têtes pleines de dents de ces saloperies végétoreptiliennes.

La faune/flore


La serliane essaie de retenir le corps de Ford, mais n’avance plus. Laissant les autres amener les humains hors de la salle, s’il n’y a pas de mouvements contraires. La serliane de Ford, ajuste sa prise sur les jambes et le buste, pour éviter de la lâcher bêtement.
Les lierres, ne comptent pas se laisser faire et profite de l’approche et du mouvement de balancier de plusieurs mètres qu’offre la serliane au guerrier, pour lui sauter dessus. Ainsi deux lierres atterrissent sur Ford et commence à le mordre aux membres, la seconde, mord la serliane pour rompre les attaches. En même temps le corps s’enroule avec la recherche clair et net de planter les “picots” blancs sous leur ventre dans les vêtements … D’autres vont lui tomber dessus et la parcelle de la serliane est en train de chanceler, puisque des morceaux de corps ont été sectionné.


Aiden Ford


Bon ! Je vais pas m’en vanter, mais des fois je devrais essayer de moins me laisser dominer par mes instincts de prédateurs ! Et comme je laisse soudain libre court à mon agressivité retenue durant des mois, je crois que je ne suis plus tout à fait moi : Il me semble que très loin dans ma tête, un certain Aiden Ford regarde une créature qui rit a la folie et hurle sa joie de tuer. Attaquer les lierres se révèla plus problématique que j’avais imaginé: les lierres vinrent en couple sur nous deux un spécimen s’attaqua à un de mes membres alors que l’autre tentait de couper ma base de soutien. Heureusement pour moi c’est plutôt lâche sur le corps et assez épais une combi, la toile est indéchirable dans une certaine mesure et donc j’avais un peu de temps pour arracher la tête de la saleté qui me collait de trop près !

Mais c’est mon alliée qui subissait le plus : l’autre saloperie lui découpait les crampons le retenant sur le plafond, je pris mon couteau de commando et me mis à découper le tête du lierre qui mordait à pleines dents ma copine serliane. Puis d’autres me tombèrent dessus essayant de coller leur drôles de pointes blanches dans la combi. J’avais pas envie de me faire empoisonner ni tester ma résistance dans cette endroit et dans cette position ! Je les pris à pleine main gantée et les effilochaient avec ma lame. Comme dit une chanson tark :” Et on leur pèlera le jonc comme au bailli de la Citadelle que l’on pendit avec ses triiippeees !!” je tirais sur ma serliane pour lui faire comprendre que ça suffisait comme ça ! Je chancelait et la baston c’est bien mais il y a des limites : je cherche pas à provoquer la mort de ce gardien courageux.

Je n’en suis pas sûr mais il me semble aussi que l’enragé en combi rouge avait des larmes qui lui coulait sur les joues. : j’avais conscience d’un drame terrible dont j’étais en partie responsable sans savoir de quoi il était question. J’avais salit le Paradis terrestre des gardiens et j’en porterais longtemps la culpabilité même si on peut ramener le plus de ses créatures dans notre jardin botanique, je me faisais l’impression d’un conquistadore après le pillage d’un village indien !

La faune/flore


Le combat était rude, le corps des lierres ne fut pas aussi facile à couper ! Le lierre c’est le genre de plante bien pénible, qui en plus d’être résistante, étouffe ses proies. Et au vu de sa génétique, la bestiole, doté de neurone, ne se laissait pas faire, leurs rages étaient aussi frénétiques que celle de Ford ! Si elles avaient pu percer un canot, la combinaison était plus résistante et leurs crocs tranchants ! Cela allait finir par se faire ouvrir ! Mais pour le moment, cela tenait ! Sans parler que le brave homme, avait un autre problème à régler… l’étouffement, provoqué par l’enroulement du premier lierre qui lui contractait le ventre jusqu’à la limite de l’inconscience, aidé par une autre qui mordait la serliane.

Finalement, l’homme réussit à décapiter la tête de la première bestiole, mais le corps ne se relâcha pas pour autant. Puisque l’autre, serrait toujours et l’abris porteur de la serliane était en train de lâcher. Cependant, celle-ci fut tranchée, mais ce ne fut pas le cas des autres qui continuait à bondir sur cette opportunité !

Le mouvement de Ford, fut la fin. Le corps de la serliane, elle avait essayé de se défendre, mais mordre lui était impossible sans risquer de toucher l’humain et de le tuer par son venin… Elle venait de mourir, le sang blanchâtre qui dégoulinaient sur la combinaison rouge de l’homme qui versait des larmes, sans comprendre, que les mouvements, n’était pas bon signe… Le corps lâcha et il eut cette maudite chute dans l’eau verte !

L’eau était chaude, les lierres continuaient à s’enrouler sur ce corps pour le broyer de plus en plus, jusqu’à faire craquer des os si besoin, chercher à percer ou s’introduire dans les vêtements, ou même faire une couronne à Ford, qui devait lutter pour ne pas toucher le fond. Un fond de deux mètres de profondeur.

_________________
#a1931c
DC :Erin Steele & Teshara Lays
Revenir en haut Aller en bas
Jeu 16 Nov - 20:04
avatar
√ Arrivée le : 16/04/2017
√ Messages : 274

Dossier Top Secret
√ Age: 31
√ Nationalité: États-Unis États-Unis
√ Gêne: Inoculation
Voir le profil de l'utilisateur
Nelly Bricks


Comment tout ça a pu dégénérer à ce point ?
L’idée de lui coller une balle avec le MP5 n’était rien de plus qu’un coup de bluff. Entre le canot qui tanguait avec l’attaque des lierres, ses chevilles malmenées et Elija qui n’avait eu qu’à faire un pas pour se planquer, Nelly pouvait tout bonnement lâcher son arme et admettre l’échec. Mais ce n’était pas dans sa nature et, même si elle tentait de garder Natasha près d’elle d’une main fébrile et maladroite, elle continuait de maintenir son arme de l’autre main en pointant la direction. C’est là que Monsieur Ford lança des ordres complètement perchés. Il voulait rester, se sacrifier ?!? Et Pedge aussi ? Mais ils étaient tombés sur la tête ?

Au moment où la situation était devenu des plus dramatiques, Nelly avait fermé les yeux en lançant un cri de surprise, mêlé de panique, qui résonna assez fort. Mais le contact de l’eau qu’elle attendait avec une immense crainte n’eut pas lieu. Une serliane l’avait sauvé de justesse et elle était en train de tanguer au-dessus de l’eau, relativement à l’abri, avec Mymy sur son ventre. Elle ne savait pas quand est-ce qu’il était monté mais elle le couvrit instinctivement de ses deux mains comme pour assurer son équilibre sur son ventre, comme pour les pétazard auparavant. Qu’il ne tombe pas sous le mouvement de déplacement de la serliane

Un coup d’oeil sur le côté lui permit de s’assurer que Natasha était sauve également. Mais les lieutenants ? Nelly tenta de se retourner pour regarder derrière elle, pendant qu’ils quittaient rapidement le lieu de l’affrontement, mais ses mouvements de torsion posèrent un gros problème à la serliane. La jeune femme l’avait senti au travers de ce corps qui enlaçait le sien : il ne fallait pas bouger. C’était un coup à tomber à l’eau, à la gêner dans cette aide, cette fuite très généreuse.
Du coup, lorsqu’ils se retrouvèrent dans le couloir, Nelly demanda avec une voix empreinte de peur et de tension :

« Non ! Mymy arrête-les ! »

Elle lui caressa la tête délicatement, comme pour chasser la peur que ce petit être semblait avoir aussi. Quelque part, c’est comme s’ils ressentaient la même émotion, qu’ils avaient ce point commun. Nelly était perdue, elle savait qu’elle ne pourrait pas utiliser son arme pour défendre ses collègues ni se déplacer convenablement. Mais elle pouvait encore réagir.

« S’il te plait, dis-leur de nous maintenir à l’abri mais de ne pas nous emmener. Je dois voir ce qu’il se passe. C’est important, aide-moi à voir la salle... »

Mymy tremblait de tout son petit corps, elle était apeurée. Elle se lova contre Nelly encore plus en prononçant des mots en lantiens. Elle eut le courage de relever la tête vers Nelly, ne sachant pas quoi faire… Elle décida de faire confiance.
« Elles ne m’obéissent pas… mais moi demander » La petite se mit à parler à la serliane, qui lui répondaient d’une voix cristalline et finalement la procession, s’arrêta dans le couloir. Laissant les deux jeune femmes, spectatrices de ce qui se passait tout en les protégeant. Mymy, alla se réfugier dans le cou de Nelly, elle semblait pleurer.
« Emeryan est encore là-bas… Il va mourir ! Je ne veux pas que mon papa meure ! »

Mais c’était compliqué. Nelly laissa la petite créature se nicher autour de son cou même si elle n’était pas rassurée à cette idée. Seulement, elle n’avait pas le temps pour s’inquiéter de cette anxiété, il y avait plus grave.

« N’aie pas peur, on va trouver une solution... »
Mymy hocha la tête, restant contre son cou.

Avec toute cette végétation et le point de vue en hauteur, Nelly ne vit pas grand chose à part la combinaison du lieutenant Ford en train de couler jusqu’au fond de l’eau. La panique atteignit soudainement la jeune femme à l’idée d’être la dernière des soldats en vie. Pedge ! Elle ne voyait pas Pedge !! Et Ford était tombé ! Il se faisait noyer vivant, non !!!
Nelly haletait, la respiration cisaillée par la pression et ce danger imminent. Les lierres semblaient toutes s’être jetées sur le lieutenant, raison pour laquelle ils étaient relativement en sécurité et que leur serliane, d’ailleurs, acceptaient de rester en position dans le couloir. C’est du moins ce qu’elle déduisit.

« Pedge ! Ford ! » Cria-t-elle bêtement. « PEDGE ! FORD !!! »

Elle ne voyait pas l’une, et l’autre était au fond de l’eau, les remous étant de moins en moins nombreux. Nelly se mit immédiatement à trembler, elle mourrait d’envie de retourner là-bas sans réfléchir plus longtemps, de trouver un moyen de rejoindre Pedge et de tirer Ford de ce mauvais pas. Elle ne pouvait pas encaisser sa façon de s’ingérer dans le rôle des autres, de faire des tirades à rallonge et de vouloir se sacrifier à outrance, mais elle ne lui souhaitait clairement pas le mal qu’il était en train de subir là-dedans.

« Ok...ok... » Se fît Nelly, les lèvres tremblantes, en caressant distraitement Mymy. Elle porta les mains à sa radio pour essayer de joindre le Major.
// Ici Nelly, pour situation : Avons été attaqué par du lierre marin et des aligatroncs. Suspectons une forme de vie nommée Elija d’en être responsable. Lieutenant Ford tombé et maintenu sous eau. Lieutenant Allen aux prises direct avec l’ennemi, pas de visuel. Serlianes ont agi en alliées, Natasha et moi sommes en sécurité. //

// Compris Bricks, nous sommes en direction de votre position. Réfugiez vous et ne tentez rien pour sauver Allen et Ford. Veillez sur Mlle Avalon. //

Il y eut un instant de silence où Nelly regretta amèrement d’avoir fait son boulot. A tous les coups, le Major allait lui ordonner de faire demi-tour, le temps de se regrouper et de revenir en force. Mais Nelly ne voulait pas, elle détestait tourner le dos et ce n’était pas pour jouer les héros. Elle avait peur, elle était toute seule avec Natasha et sans officiers, alors oui, c’était une bonne idée de repartir. Mais voilà, Ford était sous l’eau et Pedge surement aux prises contre les ennemis. Elle ne parvenait toujours pas à la voir. Impossible de les laisser tomber non ? Partir comme ça ? Ils seraient lachés ?
Son regard monta sur Natasha. Elle, elle n’avait rien demandé, elle devait être protégée. C’était l’ordre de Ford, coûte que coûte. C’était un dilemme de fou qu’elle comptait lui partager :

« Les ordres sont formels, je dois te ramener sur la terre ferme. On peut le faire... » Déclara Nelly, très tendue, en soutenant son regard. « Mais ça veut dire abandonner Ford et Pedge à leurs sorts, les priver de couverture s’ils arrivent à se retirer, de soins médicaux que tu pourrais leur dispenser s’ils sont blessés, et les laisser croupir dans une eau infestée d’ennemi s’ils s’en sortent finalement...sans oublier toutes ces serlianes qui nous ont aidé... »

Nelly laissa s’installer un silence lourd de sens. Clairement, elle ne le voulait pas partir, ça se voyait à son regard, même si le major les appelaient pour leur ordonner de faire demi-tour. Là, il n’y avait plus qu’une civile innocente et une première classe au bord de la radiation définitive. Mais elles étaient suspendues au-dessus de ce couloir, ayant le choix entre la fuite et rester sur place.

« Qu’est-ce que tu en dis, Natasha ? »

Nastasha Avalon


Natasha avait la mine défaite, la situation était tout bonnement catastrophique. Alors qu’elle avait cru sa dernière heure venue, les serlianes les avaient sauvé comme toujours. Elle regarda le bateau disparaître depuis son perchoir, livide. Un instant de plus et elle serait morte noyée… ou dévorée. Peut-être les deux ? Surement même, étant donné la présence des crocodiles. Mais très vite, les créatures comprirent que leurs proies leur avait échappé et entreprirent de les assaillir en grimpant sur les murs et un combat s’engagea entre les serlianes et elles. La réaction d’Elijah était trop suspecte, il avait sûrement quelque chose à voir avec tout ça : contrôlait-il les animaux ? Mais pourquoi les obligeaient-ils à s’entre-tuer alors qu’il aurait pu se contenter de laisser partir le groupe d’humain ? Mymy avait parlé de jalousie… Natasha songea qu’elle aurait tout le temps d’y réfléchir après, s’ils s’en sortaient. Étonnamment, Emeryan ne demeurera pas à ses côtés cette fois ci et il sembla lui préférer Pedge. Natasha se laissa balloter par leurs protectrices sans tenter de mouvement trop brusques qui auraient pu les déstabiliser : pas question de prendre le risque de finir à l’eau. Quand un lierre s’approchait vraiment trop près d’elle il écopait d’un coup de pied ou de couteau qu’elle avait avait tiré de sa ceinture. La caméra la génant dans ses mouvements, elle hésita à ses débarasser prestement en la balançant à l’eau avant de se rappeler que c’était tout de même l’enjeu initial de cette virée cauchemardesque. Elle glissa donc son bras dans le harnais de sécurité destiné à la main afin de s’en faire un bracelet de bras qui ne la gênerait pas trop.
Alors qu’ils étaient en train de rejoindre la sécurité relative du couloir, un “plouf” se fit entendre. Quelqu’un était tombé à l’eau ! Quelqu’un était tombé à l’eau ! Quelqu’un était tombé à l’eau !!! Alors que le cerveau de Natasha était en train de se répéter la même phrase encore et encore, la rouquine dû faire un réel effort de volonté pour recommencer à capter les mots prononcés autour d’elle et sortir de cet état de choc dans lequel elle se trouver. Nelly essayait de la convaincre de rester… Natasha la regarda un instant, hébétée, avant de tourner la tête vers la salle et de hurler, ignorant Nelly :


-EMERYAN, QUELQU’UN EST TOMBE À L’EAU !!!

Ils ne savaient tous que trop bien ce que ça voulait dire. Les serlianes n’aimaient pas le contact du liquide et celui ou celle qui était tombé était en train de subir les assauts de tous les carnivores du coin… et elles étaient en train de le regarder mourir, impuissantes.
Elle tourna la tête vers Nelly, les larmes aux yeux. Son petit discours culpabilisant avait fait son petit bout de chemin.


-Comment on pourrait les aider en étant perchées ici ? Je me sens impuissante !

Nelly Bricks


Nelly n’arrivait toujours pas à voir où se trouvait Pedge et ça faisait déjà trop longtemps, à son goût, que Ford se trouvait sous l’eau. Lorsque Natasha eut cette réaction, Nelly failli bien paniquer à son tour. Elle avait besoin de la jeune femme mais pas de cette cette façon là. Et elle comprenait son état. Bon sang, elle comprenait sa réaction puisque c’était exactement pareil en son fort intérieur. Mais il ne fallait pas se laisser aller.

« Natasha...ça va aller. Ne panique pas, j’ai besoin de toi... » Hasarda-t-elle d’une voix tout aussi tremblante. « Tout le monde à ses points faibles...tout le monde...même ces choses... »

-Ok… ok… je panique pas. Une décharge électrique dans l’eau pourrait neutraliser les animaux sans tuer notre allié, réfléchit Natasha à toute vitesse. Est-ce que tu as un zat ?

« Non...seulement une arme incapacitante Wraith susceptible de se dissiper dans l’eau... »

- Ok, on oublie l’électricité. Elijah est peut-être responsable de tout ça, si on le neutralise les animaux accepteront peut-être d’écouter Mymy et Emeryan. Ton arme incapacitante peut-être utile là.

« Mymy...tu vis ici...dit-nous comment faire ? »


La faune/flore


Cela se passe en même temps que l’action de Ford et Pedge //

Natasha n’eut pas de réponse de sa ceinture 2.0 mais par contre ce fut sa gardienne, qui approcha sa tête de la sienne, pour se frotter contre elle dans un signe d’apaisement. Elle parlait dans une douce mélodie, comme pour lui dire que tout allait bien.

Soudainement, suite à un bruit cristallin, les serlianes, se mirent à bouger et rapprocher les jeunes femmes du plafond, encerclant de plus en plus d’autre liane et de la végétations immobile, pour les camoufler.

« Gardiennes demandées de faire bruits d’agonie et plus bouger d’accord ? Emeryan a donné ordre de faire croire que vous mort ! »

Nelly Bricks


« D’accord... »

Nelly regarda sa comparse et hocha la tête.
« Tu es bonne comédienne Natasha ? A celle qui meurt de manière la plus crédible !!! »

C’était quasiment surréaliste. Feindre la mort pendant que les autres la risquait vraiment. Le tout enroulé dans des lianes vivantes. Nelly commençait à se débattre sans utiliser trop de force, se plaignant et s’écriant en espérant trahir une détresse qu’elle espérait la plus convaincante possible. Avant qu’elle n’atteigne le plafond pour de bon, elle cria un :
« Non ! Non ! Au secours !!! »
Puis elle râla comme si elle se faisait écraser.

La petite espagnole avait l’habitude de jouer la gamine. Mais faire le mort, c’était une autre histoire. A un moment donné, elle eu réellement peur que ce soit un piège pour les pousser à se laisser tuer sagement. Imaginez un peu ? Feindre une mise à mort qui n’en serait pas une. Ce serait sacrément tordu n’est-ce pas ?
Mais la présence de Mymy autour de son cou la rassura et elle demeura immobile après son dernier cri, essayant de respirer le plus doucement possible alors que ses pensées dérivaient fatalement vers Ford et Pedge qui étaient restés là bas. Si Emeryan avait demandé cette manoeuvre, c’est qu’il y avait un plan et qu’ils étaient en vie non ?
Nelly l’espérait de tout son coeur, attendant impatiemment l’apparition d’une issue favorable. Il fallait que ça marche !!!

Nastasha Avalon


Natasha ne se sentait pas plus à l’aise que Nelly pour jouer ce genre de comédie mais elle prit sur elle et fit un effort, décidant de s’en remettre à Emeryan. Aujourd’hui, son ange gardien avait prit les traits d’un serpent et elle lui faisait confiance. Elle gesticula donc de manière théatrâle en intimant l’ordre aux serlianes de la lâcher avant de pousser un gémissement de douleur. Hmm, il faudrait peut-être qu’elle envisage de supprimer cette partie de la vidéo sur la caméra, ce n’était pas très glorieux.
Bref, elle ne tarda pas à se faire recouvrir par les gardiens et ne pu qu’attendre la suite avec angoisse en faisant la morte.

_________________


Double compte : S. Caldwell, P. Sidney
Revenir en haut Aller en bas
Jeu 16 Nov - 20:25
avatar
√ Arrivée le : 22/01/2016
√ Messages : 893
√ Localisation : dans la galaxie Pégase


Dossier Top Secret
√ Age: 27 ans
√ Nationalité: États-Unis États-Unis
√ Gêne: Inoculation
Voir le profil de l'utilisateur
Pedge Allen


Tenir la position pour garder l’affreuse ondine devenait compliqué sous les assauts du lierre et le problème fut réglé quand la créature marine se déplaça en voyant qu’elle était menacée. Pedge la sentait de moins en moins celle-là, et elle commençait à se dire que la source de leur déconvenue venait de là, même s’il n’avait pas été clairement menaçant. Il lui avait demandé de partir, et ils allaient le faire. Ils avaient même commencé à faire demi-tour quand ces choses-là les avaient attaqués. Alors pourquoi ? Reprenant sa pagaie, la jeune femme frappa de toute ses forces, comme un joueur de baseball des rangers du Texas, sur les lierres qui commençaient à mettre en charpie le bateau. Ce n’était pas bon du tout ça ! A la dernière seconde, elle parvint en compagnie de Ford, à monter dans l’embarcation de Nelly et Natasha mais la situation était tout aussi critique ici. Avec leur crochet, les lierres déchiraient la toile souple du rafiot, voulant clairement les précipiter par le fond. C’était logique, dans l’eau, leur proie n’aurait aucune chance de se défendre efficacement. Sans parler des troncs crocos qui convergeaient de nouveau vers eux, rapidement désintéressés de la nourriture chocolatée.

C’était certainement la dernière seconde avant qu’ils ne s’enfoncent tous dans l’eau. C’était également une question de seconde avant que les lierres ne les noient. Elle aurait préféré mourir autrement qu’en se remplissant les poumons d’eau, mais on ne choisit pas vraiment ce genre de chose. Sa pagaie était cassée en deux et vue la tronche du navire, elle n’hésitait plus à se servir de sa lame de combat pour trancher du lierre. C’était plus simple à dire qu’à faire, mais qu’importe, toute forme de résistance était bonne à prendre.

Et soudainement, elle fut décollée du sol avec les autres. Emeryan s’était enroulé autour d’elle, la maintenant dans les airs avec force et souplesse. Cependant, les lierres ne comptaient pas en rester là et manifestement, ils n’avaient aucun scrupule à s’en prendre aux gardiens également. Les autres étaient suspendus eux aussi, mais ils quittèrent rapidement son champ de vision quand la serliane émeraude aux teintes désormais menaçantes lui fit part de ses intentions en la toisant directement. C’était dingue de se dire que cette créature pouvait lui parler. Bon, elle avait son accent chantant, mais elle ne devait pas être mieux avec élocution teintée des notes musicales texanes. Emeryan semblait triste, défait, mais il était sûr de son choix. La jeune femme opina du chef avant d’ajouter, pour être certaine de se faire comprendre indépendamment de son non verbal :

« Faisons vite alors. »

Les gardiens garantissaient la sécurité de son équipe, il fallait qu’ils se dépêchent pour que ces derniers aient une chance. Elle entendit un bruit de plongeon, mais elle ne pouvait pas trop se retourner sans perturber les déplacements d’Emeryan qui devait user de la partie de son corps postérieur et antérieur au nœud d’anneaux dans lequel il tenait Pedge. C’était assez fastidieux. La jeune femme tenait fermement le manche de son couteau de combat atlante dans les mains, prête à en découdre. Curieusement, depuis le bruit de plongeon, les lierres qui se mouvaient vers eux dans le but affiché de les attaquer, plongèrent, les laissant tranquille.

La faune/flore


Le bruit du plongeon de Ford fit tourner la tête d’Emeryan, qui semblait avoir peur pour l’humain. Suite à cela, il avait parfaitement entendu le hurlement de sa copine… et il donna un ordre cristallin aux gardiennes. Il toisa Pedge quelques microsecondes, avant d’agiter ses anneaux, pour la faire bouger et la mettre sur le ventre allongée.
« Essaie de faire un bruit comme si je t’étouffais, je vais faire semblant. Puis toi pas bouger comme cadavre, je vais t’amener à Elija en offrande et tu couperas son cordon »
Il attendit qu’elle soit d’accord et dès que ce fut le cas, il serra ses anneaux, mais Pedge ne sentait pas de réelle force. Plus qu’à faire la comédie, pour attirer l’attention d’Elija.


Pendant ce temps, dans l’eau Ford se battait comme un beau diable en apnée. Mais, dès qu’il tuait un lierre d’autres étaient là ! Un amas de végétaux sur son corps ! Sa combinons étanche permettait d’avoir un peu d’air, mais cela commençait à être critique, puisque la compression des lierres sur son casque, brisa celui-ci. Un bel appel d’air qui s’échappait par le haut. La combinaison, commençait aussi à être déchirée.

Cet appel, d’air le fit remonter droit comme un “i”, vers la surface où, il put prendre un peu d’air… mais au prix d’un hurlement ! Sa jambe fortement compressé venait de se briser, son tibia fracturé se rajoutait aux deux côtes fêlées dont une surement brisées. Les lierres semblaient chercher à le réduire en miette. Une technique de chasse pour immobiliser leur proie. Elles essayaient de la réduire en morceaux, n’arrivant pas à le ramener sous l’eau. Même si plusieurs fois, il buvait la tasse. Un combat difficile et la compression de son corps, commençait à être critique par endroit.

Pedge Allen


« Je ne suis pas la reine de la comédie, mais allons-y. », fit Pedge qui commençait à stresser de mimer sa mort. Elle n’était pas douée pour s’exprimer avec son corps et elle avait peur de faire capoter le plan d’Emeryan, qui semblait déjà un peu fou. Les anneaux se serrèrent autour de son corps. La liane ne mettait pas trop de force, et la jeune femme espérait qu’elle le fasse un minimum pour que ce soit plus crédible. Les anneaux s’enroulèrent et la pression augmenta, sans qu’elle soit énorme. Elle pouvait respirer facilement. Elle fit mine d’étouffer, en s’agrippant au corps d’Emeryan pour essayer de l’écarter. Forcer pour de faux lui permit de faire monter son sang dans ses joues et dans sa tête, ajoutant à l’effet de l’étouffement.

« Lâche moi putain ! », éructa-t-elle pour en rajouter, en toussant, et finalement, petit à petit son corps se détendit et elle se laissa pendre tranquillement dans les anneaux de la liane. Elle était mieux que Cotillard dans Batman non ? Elle espérait que ça ferait illusion. Quoiqu’il en soit, elle n’était pas très rassurée de sentir ses membres tout mou. Elle préférait être contractée, de peur de tomber, mais le serpent liane assurait vraiment le coup.

La faune/flore


Juste après Natasha et Nelly mimait aussi leurs morts … De quoi faire relever la tête d’Elija vers Emeryan qui avançait vers lui confiant. La serliane, se déroula, pour avancer et mettre Pedge vers le sommet du cordon, qui semblait parcourir une large zone dans un rhizome, relié aux machines et à d’autres éléments comme des sacoches de plante. La serliane, descendit sa tête, pour parler avec Elija, remontant le corps de Pedge vers le haut.

« Tu as fini par comprendre qu’ils étaient dangereux …»
« Oui… Tu contrôles les lierres maintenant ? »
« Oui, le nouveau protocole génétique de la nouvelle génération a abouti enfin à un contrôle plus poussé… Tu ne m’en veux pas, d’avoir endormie les tiens près du laboratoire alors ? Et pourquoi parles-tu leur langue ? »
« Non, il était nécessaire pour tuer la menace…Même si j’aime pas quand tu m’utilises pour tes fins ! J’aime bien … Et ça me culpabilise d’avoir tué Avalon, je l’aime beaucoup … » Le plantage d’aiguille n’avait pas servit qu'à apprendre l’anglais apparemment.
« Ne soit pas triste, c’est pour vous, ils vous auraient tous tué… des animaux de laboratoire comme Olivie. »
« Oui comme Olivie … Il va mourir atrocement Aiden Ford… »
« Oui, mais cela me sert pour mes recherches. Les lierres sont fascinants »
« J’en fais quoi du corps ? »
« On le mettra dans une cuve pour faire de l’énergie et nourrir mes futures créations … les prochains serviront à ça ! J’ai un grand projet ! C’est de l'énergie facile ! Ils seront notre nourriture ! » Il semblait fier !
« Bien, je vais la déplacer alors »

Pedge Allen


Ca avait fonctionné. Emeryan était en train de la hisser vers le haut du cordon tandis qu’il descendait parler avec l’ondine. La conversation confirma les soupçons de Pedge quant à la culpabilité de l’arbre dans toute cette mascarade. Il était bel et bien derrière cette attaque soudaine des lierres. La serliane semblait faire exprès de parler anglais pour que ses doutes et ses soupçons soient levés. Ce n’était pas plus mal, car la jeune femme aurait eu des scrupules à s’attaquer à un innocent, sans parler qu’elle sentait qu’elle était sur le point d’anéantir quelque chose de plus grand qu’elle, sans trop savoir quoi exactement. Mais tout ceci existait probablement avant leur arrivée, et probablement avant l’ascension des anciens. C’était logique. Depuis combien de temps cet arbre ondin arpentait-il son laboratoire pour mener ses expériences à bien ?

Ils parlèrent de la mort de Ford. Pedge fit les gros yeux. Il était temps d’agir, peut-être qu’en coupant ce fil, elle lui permettrait de vivre ! Surtout que l’autre se prenait un délire de grandeur en imaginant déjà se servir d’eux comme de la nourriture ! Il était devenu pire qu’un Wraith. Et Pedge détestait les Wraiths. Alors pire… Fallait pas chercher plus loin, surtout que l’équipe était en danger. Elle devait agir. Sa prise sur son couteau se fit plus ferme. Sans crier gare, elle attrapa le cordon et elle commença à le cisailler avec la lame bien affutée de son arme. Elle était déjà prête à se cramponner à cet espèce de rhizome si besoin, au cas où Emeryan devait la lâcher. Ainsi, elle serait toujours en place pour continuer de le découper si c’était plus costaud que prévu.

Aiden Ford


Le “déjà vu” ! Voilà ce que je ressens quand je me retrouve sous l’eau, Me voilà revenu au moment de l’accident avec les même sensations. Sauf que la dernière fois j’étais inconscient ! Je pouvais me battre comme un beau diable les plantes étaient toujours là ! Ils ont finis par exploser mon casque, j’ai pu sortir un instant pour aspirer de l’air mais ces pourritures me serrent et mon tibia casse ! Bordel ! Encore ! Mes côtes me font souffrire, respirer est difficile mais je n’abandonnerais pas ! J’ai le temps de voir vite fait Elija et Emeryan avec un corps flasque : Allen ? Morte ? L’alpha nous a trahi finalement ! Je suis dans une colère noire ! Je sens dans mes veines l’adrénaline qui se mêle avec l’enzyme. Mais tout ça pourquoi ? Je serais brisé de partout avant d’avoir détruit toutes ces plantes ! Sans le lierre constricteur, j’aurais mes chances avec les troncs, mais pas là !

Réfléchis Ford ! Allen est peut-être morte tuée par Emeryan ou Elija, Bricks et Avalon ? Faites qu’elles aient réussies à fuir ! Ou peut-être sont-elles mortes, elles aussi ? Trahies par les lianes, réfléchis ! Réfléchis ! Je sais ! Cesser la lutte ! Se laisser couler ! Compter sur mon corps pour se mettre en état ralentit comme la première fois ! Je m’enfonces dans l’eau en retenant mon souffle un moment, aussi longtemps que je peux. Mon sac est entravé par les lierres, pas le choix : je mets toute mon énergie à couper et trancher dans la masse végétale et dans mes lanières. Je ramènes le sac face à moi, les lierres tentent de le prendre en otage, je coupe d’une main en retenant le sac, je le tiens serré et un moment cesse de lutter pour fouiller à l’intérieur à tâtons, je trouve ce que je cherches et mets le dispositif à ultrasons en marche, ça ne chasse peut-être pas les reptiles du coin mais avec du bol, ça pourra troubler les ondes d’Elija, puis je coupe encore les plantes vivantes qui veulent m’écraser et lâche le sac qui tombe au fond où je vais le rejoindre. Et maintenant, dormir et attendre la résurrection s’il y en a une ! Mais je suis un optimiste !

La faune/flore


Les ultrasons ne semblaient pas du tout affecter Elija, qui n’entendait pas les ondes dans l’eau. Par contre, cela fit fuir les croco tronc qui allait vers lui. Quant au lierres… Elles continuent leurs acharnements, mordant la combinaison et serrant les autres membres, pour les briser.

Soudainement Elijah se met à s’agiter en secouant sa tête.
« [color=#663300] Quelque chose attaque mon cordon de vie ! » Se met-il en colère !
« Emeryan fait quelque chose ! Un lierre m’attaque ! »
« Je croyais qu’ils t’obéissaient ? » Dit-il avec une pointe d’ironie
« Va !!!! »
La serliane, hocha la tête, faisant mine de remonter… Puis, se mit en forme de S, regardant Elija tristement.
« [color=ForestGreen] Elija… excuse-moi… C’est pour ton bien » Et sans plus attendre il se projeta sur lui, le mordant au cou, lui injectant son venin. La sirène se mit à hurler et gesticula de plus belle, alors qu’une toile d’araignée partait de la morsure. Emeryan se retira vite remontant sa tête avant de se prendre un coup. Il alla vers Pedge.

« Fait vite ! Il ne mourra pas de mon poison, son organisme va le guérir ! » Sifflait-il de sa voix cristalline.

« Des traîtres !!! Vous êtes tous des traîtres ! » Son corps convulsait de plus en plus.

Pedge Allen


Les mots d’Emeryan motivèrent Pedge encore plus et elle bloqua sa respiration pour se donner à fond l’espace de quelques secondes pour couper le cordon de plus en plus vite jusqu’à ce qu’il lâche une bonne fois pour toute ! Elle sentait les soubresauts de la créature en dessous d’elle, prise de convulsions suite à la morsure de la liane. Et soudainement, elle se retrouva avec les deux parties dans les mains. Elle reprit sa respiration, haletante, en nage dans sa combinaison NBC liée sur ses jambes qui lui tenait affreusement chaud.

La faune/flore



Du liquide blanchâtre s’échappait des bouts tranchés… en bas Elija était paralysé et s’écroula de tout son long dans l’eau, le cordon s’échappa des mains de Pedge. Emeryan, du resserrer ses anneaux, pour pas qu’elle se fasse bêtement emporter…

Le corps entier de l’ondine était en train de flotter et bougeait doucement, comme perdu. Et soudainement, le corps d’Elija était animé de soubresaut et des lierres lui sautaient dessus, pour planter ses picots.

Le corps de Ford, fut soudainement relâché après, son autre tibia allait se faire briser mais par chance il n’aura qu’une fêlure sur l’os. Tous les lierres partir à l’assaut de l’ondine, qui représentait une source d’énergie plus grande ! Elles le brisaient, on entendait des bruits sourd d’un squelette existant brisé… et le corps devenir de plus en plus sec. Les machines s’éteignirent ainsi que les lumières…

Emeryan, avait la tête baissée et semblait profondément triste. Mymy pleurait dans le cou de Nelly…

La serliane, descendit Pedge vers l’endroit où il devait y avoir Ford qui remontait à la surface, pour qu’elle l’aide. D’autre serliane était en train de descendre vers l’eau, pour aider Emeryan à soutenir le corps de Pedge.

Pedge Allen


C’était une forme de victoire non ? Ou un bref répit ? Pedge ne savait pas trop, toujours est-il que les lierres se détournèrent de Ford pour se concentrer sur Elija qui venait de s’écrouler dans l’eau. Il était victime de ses créations. Une fin atroce s’il en était, mais qu’il leur réservait sans aucune forme de pitié, alors la texane n’en avait pas plus. Elle préférait largement voir l’ondine se faire massacrer que ses coéquipiers. D’ailleurs, Emeryan était déjà en train de la descendre vers le lieutenant qui semblait avoir passé un sale quart d’heure aquatique. Les renforts arrivèrent pour la soutenir, tandis qu’elle se penchait vers l’amérindien.

« Lieutenant ?! Vous m’entendez ? Il faut qu’on se sauve d’ici ! ». Elle ne savait pas si c’était une bonne idée de le tracter vers les lianes ou s’il convenait mieux de le traîner dans l’eau jusqu’à la rive. Mais la présence des troncs étaient problématique. Néanmoins, dans l’eau, il souffrirait moins. Vu les bruits de craquement qu’on entendait du côté d’Elija, Pedge se doutait que le lieutenant avait dû subir la même forme de pression, sans se douter un instant qu’il avait des membres cassés.


_________________
Aiden Ford Theme:
 





Médailles:
 


DC : Herakles Coeur de Thaïr
Revenir en haut Aller en bas
Jeu 16 Nov - 20:27
avatar
√ Arrivée le : 16/04/2017
√ Messages : 274

Dossier Top Secret
√ Age: 31
√ Nationalité: États-Unis États-Unis
√ Gêne: Inoculation
Voir le profil de l'utilisateur
Aiden Ford


Je n’étais que souffrances : les lierres voraces me serrent plus que la plus chaude des concubines du royaume tark. Je sentais la pression du sang battre dans mes tempes et dans mes oreilles, mes globes oculaires derrière les paupières semblaient vouloir jouer au billes avec les aligatroncs. Je ne voyais rien mais j’imaginais bien une scène comme le final de Total Recall. J’allais crever ! Brisé, réduit en pulpe de chair pour nourrir des saloperies génétiques qui n’étaient pas des wraiths, mais qui feraient de bons toutous pour ces monstres ! Et puis soudain ! Plus rien ! Putain ça faisait presque aussi mal qu’avec les écrasements ! Je devais pas être très beau à voir, enfin, pire que d’habitude ! Mes bras, mes jambes, mes côtes et même mon crâne hurlaient leur souffrance. Comme il ne se passait toujours rien au bout d’un moment et que mon oxygène contenu dans mes poumons commençait à manquer. J'attrapais mon sac et dans un effort surhumain (pour moi on devrait dire surmutant !), je remontais à la surface, heureusement pas à 100m plus haut ! Je suis sortis ! Avale une bouffée d’air qui me brûle, mes côtes sont sûrement cassées, mes bras doivent pas trop être loins du compte aussi et mes jambes, au moins une est brisée je le sens l’autre est douloureuse mais c’est pas la pire des douleurs que mon corps exprime.

Toujours les yeux fermés je sentis que quelque chose s’approchait, je me raidis et j’entendis une voix venue d’outre-tombe, Allen ? Vivante ! Des larmes, pas seulement de douleur coulèrent de mes yeux, heureusement que j’étais trempé et dans l’eau ça passera inaperçu. Je tentais un sourire et dit en toussant un peu :

” Je vous ...entend Allen ! ….C’est la plus be..belle voix du mon….monde ! Mais, vous savez ? Je suis bien là ! Vous devriez essayez les os brisés, ça détend à mort !”, je parti d’un rire qui s’éteignit dans une quinte de toux ensanglantée !

La faune/flore


Les troncs avaient disparu, les lierres mangeaient… Tout le monde semblait aller bien pour les vivants. Nelly et Natasha, furent ramenés dans la salle au-dessus de Ford. Les serlianes ne savaient pas quoi faire d’autre, ne voulant pas toucher l’eau, cela se voyait. Emeryan, alla frotter sa tête sur celle de Natasha avant que Mymy sorte du cou de Nelly pour sauter sur le bidou de la rouquine et réclamer un câlin de la serliane.

Emeryan, attendait que les humains, fassent ou demande quelque chose. Aiden étant mouillé semblait avoir du mal à nager seul, sa position de planche était la plus adaptée.

Nastasha Avalon


L’attente fut moins longue que prévue et les serlianes se dénouèrent en douceur pour les libérer de leur cage improvisée et les ramener sur la zone d’action. Ford flottait dans l’eau et il semblait inconscient ou presque, Pedge était à ses côtés à ras de l’eau, retenue par les serlianes, le cadavre d’Elijah était en train de se faire assaillir de toute part par les créatures qui tentaient de les tuer précédemment… Le spectacle était désolant.

L’état de Ford était inquiétant. Apparemment, il s’en était sorti et Pedge veillait à le maintenir hors de l’eau mais elle ne pourrait l’ausculter qu’une fois de retour sur la terre ferme. Elle n’en pouvait plus de cette eau verdâtre ! C’est alors que la jolie serliane aux couleurs émeraudes vint lui faire un câlin en frottant sa tête contre la sienne. Natasha lui tendit les bras pour le serrer contre elle comme elle l’aurait fait avec un être humain. Elle savait qu’Emeryan avait joué un rôle important dans la mort d’Elijah et, si elle ne ressentait aucune empathie ou tristesse pour la disparition de celui qui avait tenté de les massacrer, elle avait du chagrin pour sa serliane et la petite chose qui pleurait autour de son cou. L’espace d’un instant, elle se revit vingt-et-un ans plus tôt lorsqu’elle avait dû annoncer à sa petite sœur de cinq ans que leur mère ne reviendrait probablement jamais. La mort d’Elijah était plus définitive mais en un sens ce n’était peut-être pas plus mal. Ce pauvre Mymy ferait son deuil et pourrait avancer plutôt que d’attendre toute sa vie que son géniteur ressurgisse dans sa vie. En attendant, sa détresse lui serrait le cœur. Il n’y avait rien de plus horrible que de perdre un être cher, elle en avait fait trop de fois l’expérience.


- Je suis tellement désolée… murmura-t-elle.

Le combat était terminé, il allait falloir retourner dans la salle principale et retrouver l’autre équipe. Ils avaient surement beaucoup de choses à se raconter et Ford avait besoin de soins en urgence.

« Il était fou… Il donnait la vie … et non pour la détruire » répondit péniblement la serliane.

- Ce n’est pas terminé Emeryan, il faut sortir Ford de là.
La serliane hochait la tête, tout en se retournant au dessus de Ford, pour étudier comment le sortir de là sans toucher l’eau.

Pedge Allen


« C’est l’accent texan, ça fait toujours son petit effet », répliqua-t-elle, soulagée de voir qu’il était en vie. « Vous m’excuserez mais je ne vais pas retenir votre solution pour aller bien. » Il fallait l’extraire de là. Il disait avoir les os brisés, et elle était certaine qu’il était dans le vrai. Ce n’était pas le genre de la maison de se plaindre pour rien. D’ailleurs, il ne le faisait pas vraiment, il était plutôt dans l’humour et le constat. Il était dans un sale état quand même.

« Emeryan, est-ce que vous pouvez nous ramener vers la plage ? », fit Pedge qui devait prendre les devant pour ramener tout le monde, dont Nelly et Natasha qui étaient suspendues au dessus d’eux, ramenées par les Serlianes. Les troncs n’étaient plus visible et elle prit le partie de laisser Ford dans l’eau. Ce serait moins douloureux pour le trainer jusqu’à la terre ferme. « Lieutenant ?! Attrapez la sangle de mon fusil », fit-elle en défaisant la bandoulière de son Colt M4. Elle avait enclenché la sécurité et elle tenait l’arme par la crosse, pour laisser pendre le cordeau.

« Oui, nous pouvons ! »
« Ok merci, je récupère le lieutenant et on fiche le camp. », fit Pedge pragmatique.
« D’accord »

Aiden Ford


Je levais péniblement le bras tenant le sac ” Dedans ! Grappin et cordes peux pas plus !”

Pedge Allen


Pedge attrapa le sac avec le matériel à l’intérieur. Elle allait devoir arrimer le soldat pour qu’elle puisse le tracter avec l’aide des lianes qui se refusaient à toucher l’eau. Ainsi, elle ne le perdrait pas en route, et quelque part, elle préférait faire comme ça. Au moins, elle pouvait conserver son fusil et ainsi le couvrir tout en tenant la corde, afin de palier à toute forme de danger. En se penchant un maximum, et après avoir récupéré la corde, elle parvint tant bien que mal à faire passer un bout sous les épaules de Ford. Ainsi elle le tirerait sur ses deux bras, dispatchant les forces de traction pour atténuer les douleurs, à moins bien entendu qu’il ait un bras vraiment trop amoché pour cela. Une fois l’amérindien accroché, elle fit signe à Emeryan qu’ils pouvaient tous y aller.

Nelly Bricks


Il ne fallait pas être claustrophobe.
Enfermée dans ce cocon de verdure, Nelly tentait de ne pas bouger, de respirer calmement. Mais c’était difficile de garder son calme. Cela prenait trop de temps à son goût et elle ne savait pas du tout ce qu’il se passait en bas. Pedge et Ford n’étaient pas à l’abri, eux, et il fallait faire confiance aux serlianes alliées. La petite espagnole se concentrait sur cette idée. Et aussi, histoire de se calmer, de l’énorme câlin surprise qu’elle ferait à Pedge lorsque la gamine serait de retour. Parce qu’elle ne mourrait pas ici. Personne n’allait y rester, il fallait positiver ! D’ailleurs, elle sentait le “Yaya” en train de pleurer autour de son cou et cela la chagrinait à son tour. Mais elle ne pouvait pas parler, ni amener sa main pour le caresser. Alors elle plia silencieusement son cou pour exercer une douce pression qu’elle espérait compatissante pour Mymy.

Finalement, malgré le boucan qu’elle entendait malgré tout dans la salle, les serlianes se délièrent pour leur permettre de revenir. Le fait de voir Natasha, qu’elle n’aie pas eu de problèmes, la rassurait déjà. Mais être amenée dans la salle et voir Pedge en vie l’inonda d’une joie qu’elle s’empressa de cacher, d’autant plus que Ford semblait très mal. Mais toute l’équipe était là, c’était l’essentiel. Il n’y avait pas de cadavre déchiqueté comme les canots, pas de morts à annoncer à la radio. D’ailleurs, il lui semblait que cette chose dans l’eau, recouvert de lierres, ne pouvait être qu’Elija et que Pedge n’était pas étrangère à cette soudaine issue favorable.

Natasha allait avoir besoin d’espace pour s’occuper de Ford. Pedge, d’ailleurs, s’occupait de le faire rapatrier avec les serlianes, elle n’avait pas le temps de rendre compte. Nelly, en revanche, pouvait s’en charger. Elle n’avait rien d’autre à faire que d’aider son équipe de cette manière là.

// Major, ici Nelly pour situation : hostiles neutralisés, le lieutenant Ford est blessé. Nous retournons tous sur la terre ferme avec l’aide des serlianes. Le lieutenant Allen reprend le commandement. //

// Bien reçu Bricks, nous serons bientôt là. Tenez bon.//

_________________


Double compte : S. Caldwell, P. Sidney
Revenir en haut Aller en bas
Ven 17 Nov - 13:12
avatar
√ Arrivée le : 01/08/2015
√ Messages : 379
Voir le profil de l'utilisateur
Revenir en haut Aller en bas
Contenu sponsorisé
Revenir en haut Aller en bas
Page 1 sur 1

Sauter vers :
Vous ne pouvez pas répondre aux sujets dans ce forum
Atlantis Insurrection :: Cité d'Atlantis :: Les autres ailes de la Cité-